Description :
From Genome Similarity Track
Location :
Scaffold_2973:57- 1429
Transcript NameFunction/comments
Phyta_totarag14978hypothetical protein

Sequence
1372 bases(100 bases per row)
CTAACAGTTTGTATATTACAAAATATCTGTCTAACTTGAAATATAatattgtgatgatagattgagccctccttctgtcgtcttgcagTGGTCTTGTCCG
GGAATATCTTGAACAACAGGTTGATTTCGCCCATGTTATAGGCGTCATACAGTGCACAGCGCTTCAGAACATCGAAGACTGCGGCGATTTTAACAttatc
cgagttgaaccttgaataactgattttgaaacaatttattgCAAATGATAGTTCAAAAAAGTATCATTTGTAAAATAGAAAACATTTTAGCGTGTCCGCC
TTTGAATCCAATGTTGTCGGAGGTTGACCGGGCAAAGGTgtgcttggtgtttctgagaatgggCGAAATTGTTTCTTGGGCTGGAGCATTTTTCAGCTCG
AGatcgcgtgcagcacgttcagtcAGTTTTGCCTAGGAGAGGGAGAGGTCCCGCTACAAACAAATTGTCTTCTTTTATTCGTAGGTTAGGCTAACTGGGG
ACTTGCGGGGACAGTCTACCTGCGAGGCGCCATTGTTGGGCTCTGGAGCAAGCctggaaatgaagccagcactcaTGAGCTGGCGGAGGGCACTTTGGCA
GTGTTTGGAGCTATATACTACCGCGGTAGTGAGTGGACAGTACGTAATCCGGTAAGATGATCGacttgctatacttgatagcaaatgtgtccacgagcca
TATTGAGTAAGGGAGGTTCGTCTGTACCGAGTGTTCAGTCAACGGCGGTGGCAAGGCGAAAAATCCAGTGGACGATCAAGATCGATGTAAAAATCAGATT
GACAATCACGATCGACGGACGCACGATCAAGATCGCGATACGATATGGAAGACTCCTAAGATCACGGTGTACATACGAGTGTAAATCGGAGTGGCGATCA
AGGTCACGGGGCAGAGACAGGAAAACCCCCAGTGGCCCCAGATCGCGATCTCGAGGAGCGTAACATGCACCCATCAAAGATTAGGAGGCGTACACACATT
CAGGGCCTGTTGATCtagaagaagacgaacaagTATACTTCAAGGAAGGAGGCGAGCTGTTCGAGGAAGCCGTCGAAGGTCAGATGGTGGTGTTATCCGA
GGTTACGGCGATGACCGAGGAGGTCAAGATTGAAGGTATTCAGGTTGGTGATCTCCACGACAACACGCCGGAAGAGATCGACCGATTGCGGCGAATCATA
TGGCGTCGTCGGCATCTCCTGATTGGGAAATGCAACGCTTTACCACCAGCTGTGAAAAGGACGATATGCGACATAGGCGTGGGAGGGGCTAAGCCCATCT
CCCAGCGGGAGCGAAAAGTCGACCCGCAGTTCCGCGAAAATTGTTCCAGCTGATCAAGGGCTATTGTCCGCG