Description :
From Genome Similarity Track
Location :
Scaffold_171:56994- 58543
Sequence
1549 bases(100 bases per row)
GCCCCGTCGCTAAGTCCGCAGACGAGAGCCAACGCGCGAGTGTCCTGCCAAGCTATACTGAATATAAGATGTTTATTAATGTGTCTCTCCGGATTTTAGG
CAAGATTTTAGGAGATTATGTTTAGGACAGATTATTAGGAATTCGACGATTTTAGGTACGCACAGGGGAGTTCCTTAGATATGGCCGCACAATTGAACTC
GTTGCTAACTATTGCATAGGAAGATGCTGGTCAAAAAATCCTCACGCTTAGATAATGCAATCCGTACGAGCCAAATCTCAGCACAAATATTATGTGTTGT
TGTTCCAAGAAACGATAGAAGTGTATGAGCTCTACACGTCCAGATTCCGTTGTCATTTCTTGCGTCATTTTGGTCTTCATCGGCTTGCAATCATCACCAG
CTTGCTCAGTTTTCCCCTCGCCACTTCGATCGATAATGCACACAAACGCCATACAAACCAGCGCCACGCCCATAAAAATCGACTCAGTCTTCACGCAATC
AGGCCACTGGGTCTGCAACGAGCGATAGCCTTCCGGATTTATTGAAACTGGAGAAGACGGTGACGTTGTATTAACTGAGCGACCGATTGCCTTGCTCCCG
CACCACTTGTGAACTGCGTCTGTGATGTTGAAAGAATCCTTGAGAAGACTCTGACTGTGTGTGTCAGCTGAAAAGTGTCCCCTTTGTAATTGAGTAGCAG
GTTGCATTTGAAGATACGCCATATTCAACACCTTAGCTCTGCAGTAGTCCCAGACGCGCGTCACGGACTCCAACTTTACTGTCGTGTTGTCACTAGAAGC
CGCCATCCCCAGCACTTTACGAACTTGGCCTTCATCAGCACAAATCTCATCACCGCGCAGGTCGCAAAAAAAGTCGTTAAACTTTGCGCGAAACTCGGGA
CTGGCGACCTGGGCTTCGTAAACCAAAGCAACGGCGTTCGCGGCGAACAGCAAGGCAAGCATGAAGCTTCCAAATACGACTATGACGGCGCGGAGGCCAG
GGCCGTCTCGCAAGGGTCCATTGCAAAGCAAATGGGCGCTGGTAAAACCCATCACGAGCGTAAGGACAAGAGCGAGAAGCCACGCATGTCAGTAGGTCGA
GGCTGCTACTGTCGAAAGGTGTTCCGCCCCTCGTCGGGAGCGACACGGCGGTACGGATCATGCCCAGAATCAACAGCAGAGCAGCGGAGACCTCAAGAGA
CGCGGAGACTTTGGTCTTGCGGGAATTCACTTCCGGCATCGCACTTGTTCTTGTTTGCTGAGAGAATTGAGAATGCTGTATTGTTCACTGTGTTAGTCCA
CCAACTAACGATTGACTCTTTTAGCCGAGATGTGTCACGTGTCATCAATCAAAACACCGGCAAGCTAGTGAGGACTTCAAGTGACGGAACGTTGCGCAAG
AAATGGTAGTCTAGCTACAGATTCCCACTGCTAAAGGTAAGCGCTTTACGTAACCGAACATCTATCGATTAACGATATCACTACTGCAGTGCTTGATTAA
GTAATAATTGGTTTTAACACTGACAGTCAATATCTTCGAAATCCCTTAT