Description :
From Genome Similarity Track
Location :
Scaffold_229:56980- 59900
Sequence
2920 bases(100 bases per row)
GATCTCACATACTGCGCGCACACGATTCCGCGCCGACCAAAATTGCAAACAAATTTGACTCTAACGTCAATGTGCTATGCCTTGAGTGACGACACCTCGC
CCTCGATCTTTCGAATTGCCGCCTGGTTGTCGACGTGCATTAGCATCGGCAACTCTGATGCCATTCCGATCTCGCTAAGCATCTCGCGCACGACCAGCAG
CTCGCGAGCAATCTCTGACACCGCCAAGAAATCCGCATCCATTGTGGAAAGGGACACACCGCCTTGTTTTTTGGAGCTCCAGCTTACCGCCATGCAGTGT
AGGAGGATAATGCCGCCGGTCAAAGACTTCCGGTCGCTTTAGTCCGCGGCATAGTCGGCGTCGCTAAATGACTCGAGCTTGATTGACGCGCAAGCGGCGT
CGCTCGGCGTCATGATAATCTTCATTGCTTTTGTGCCCTTAAGGTAGAAAGCCACACACTTCGCGAGCTTCCAGTCATGAAGCCGCGGTTGATGCGTCTG
TCGCGTCGTCTTGTGAACAGCAAACTCGATGTCGGGTCTCGTGCATCGCGCGACCCAAAGTAGAGATCTGACGAGCAACTGGAACTCTTTGATTGTTGAC
GTTCCATTCGTACTTGTGGCCTCAAGCAGCGCGCTATCGATCGGCCGTACTTCATAACATTCGGCGCCGATCGGTGCGAGTGTCGAATTCGCTTCCGTGA
TCCCATGTTCACGCATCAAGTCGATGATCGCTTCTTCCTGGTCCAGAACGTAGCCGCCGTCGCTATCGAGCGCCTCTATCATACCAATAAACTTACTTGC
ACGACCGAGGTCCTTGATCGACAGGCTCACGAGGCTGACGAAAAATGATCCACAGCAGCTGCTTCGGTGCCAGTGACAAGTAAGTCGTCGACGTAGACGC
CCACCACGAATGTGTCCTTTCCGTCATGCTTCCAGTAGAGGCACATGTAAGTCATACGCTGTGTAAATCCCACGCTGCACAGCTTCGCATGCAGGAGCTG
GCTCCAGCGTCGGCCGGCTTGCTTGAGGCCGTACAAAATCTTGCGGAGATCGAGTGCCAGAACCTGCTTACTTGCCGCACCGAGCTTCTTCAGCGTCGCT
TCGTCGATGTCCATGCTAGCGGTACCTGGATAGTAATCTCGAGGTGAGACTCTTTGCCCGCCTTCACATATGCATTCGTTATGTCACCATACTTAGCGGG
TACGCCCCACGTCGCCACCAGAGTAAATGTCGGCATTCACCTTACGCATAGTTACTTATAGATTCACTCGTCAGGCTTGCAATGATACCGACTCACGAGT
CAGCAAATTAGTAAGGGGGTCTAATACGCGGAGGACTTTATAAATAGTTTGAAATGGCGATCGGTGCATCTGCATCATATTACGACACAATAAACCGCGA
TGCTAAATTTTTTAGTCTTGTCAAGTTGCTGCTCACATACGTATTCACAAGGTCAATTTTCTCGGAGAAAAAATAGCAAGCTTACCGCTTTCAACTGTCA
ATTTTTTATCAGGTGATCGACTTCACATTAGACATGTCCATGACGACCGCGAAGTTGATCTGGTAGTCTATATCAAAGACCTGCTCGTTTCCGCACGAAA
CAAGTCGAGCCTTGAGTCGCTCGAGGTCGCCGTGCGCATAAGTCTTCATCTTAAAATACCCACTTGGTGTGTAGCGCGTTGCTGCTGGGCGGTCGCTTGA
TTGAGCGCCACACGCCGTTTTCTTCGAGCGCTTCAAGCTCTTCACGCATGGCTTTTCCCAGCCTTCGCGTTTGCTGCTGCGTATCGCTTCCCCATAATTA
TTGGGATCGCACTCGTAAACTTCAGCCACCACAATTTCGTCACGTGCTGACTCCTCCTGAACCCCGGACGCCTGTGCACGCTTCATCGCGCTGCGCGTTT
TGTGTGCTGCAAGCGTCCATGACTTGGACTTCTTCTTTCCACTTTGGATCGTCAAAAGCGGTACTGGATCTGCCGGCTTACCGTCGCTGTCGAAGCTGCA
GCTGCTTGATCCTTGTAATTAAACGCTCTCTACAGCTGATTATTCTGCGCCTCGCTGAACGTCTCAATATCTTTCACGTACTGCGTGACTGTGATTTTGT
TTTCATTCTGATGGAACACCCTATAGCTCTTGGTTTCATCGCTGCGTCCGATCATGACGCCGACTTGCGATCGCTTCTCCAGCGAGTTCATGCGCGGGTC
TCGGTAGACAGAACTGACAGAGTCAAAAGCTATGATGTCTCGCAACTCAGGCGCGTGCTTTGTCATCATCTCTAAAGGTGACGCGCTCTTCGGGTTTGCA
CTTGTCGGGTTGCAGTTTAGTATGTATGCTGCATATTCAATCGCATCACCCCAGAAAGACACGGGCAGTCGACTCGCAAAAGGTCGTCGATCACGACATG
TTCAACACCTTTCGGTGCATACGCTCGGCTTTGACGTTCGACGCCTCGTTGCGCGCTTCGCTCACCTGTCGTGCGACGCCAGTCGACTTGCAGAAGAGGT
CGACGTTCGCGTACTCGCTACCACCGTCCGACCGTTTGACGTGGATATGGCAGTCAAACTGGAGTTTAAAGAACGTCAAGAAGTGTTCGAACACTTTCGC
GGCTTTGTCCTTCGTCGGAGCGAGGAAGACGAGGCAGTAGTTTGACTTGTGGTCCACGAAATTTACGAGGTACCGGTTTCCGAGCCGGTCGTTTGGGGTC
ATCGGACCCTTGAGGTCCGAAGAGATGACGCCGCTAACGCGGTCGACAAGCGAGTTGGCGCCCGTGTCCTTGCACGACTAAGAATTCTTGGTTTGTTTGC
CTTAGGCGCACGAAATGCTCGTCGGCCTCGCACGATCCGTGAGTGTAATACCGGACACTAGATCCCTTGCCATGCTCTCGACCGTGTCGTACGCCAAGTG
ACCCAGGCGCTGGTGAAAGT