Description :
From Genome Similarity Track
Location :
Scaffold_8:569642- 571505
Sequence
1863 bases(100 bases per row)
TGATACCGAGAACCTTGCGCAGCACGAAACAAAGCCTCGTAGGCTGGATACACGAACACCATCGTGGTCTGGACTGACGCAAAATTCATGAACCGTAGCA
ATTGATCTCGATGCTGCAGTATTTGCCGTAGAACTCGCGTCCCCACCACAATGCGAAATGAGATGAACTGTATCACGGAGCTCACGGGAGAAATGACCAC
CATATAGAACGGGACAGGAAATGTTGGGAGAGAGGTGAGGCCCATGGAGCAACCCGTAATGCCAATCGAAGCGCAAAGCAGCAGTGACACCTGCCGACAC
GGCGGGATCACGACGCCATCGACAAAGTAGGTCGCTTGGACAATTATGGACCGACTTACTGCGAACGTCACTATGCTCGCGCGAATCCAGAACCCGTAAT
TCTTGTGCCACCCCTCTTTTGGGTCTTGCAGGGGGATCATTTCTTGGACGAACACCAGGGCTACCATGGGCATGATACTTTTTAGGCACACAACAAACAC
GCGGAATAGCGAGGCGTTAACCGTGTAGGTCTCCAGCGCAAGTGCGCGGTGGATCGAGTACTTCCCCACGTAGTAGCTGACCTGAAGCCGCTTCCAGCCG
CGGAATAGGTGAAGTGCGTATGAAGCAAGCAAGGAGACCATTCGTTCTTCGAGTTGTTGGTGTGGACAGTCAACAGATAGCGCCCGAGAACAATGCTGCT
CATGAAATCTATTCGTAGCCCGAACCAGGACGTCCAAACTGCTACCTTAGTCAAGTGTAGACTATTGAGCTTTAGAATACATGTAGCTTTAGAAAGCTCA
ATAGCCCAGACTTGACTACGGTAGCAATTTGAAAGCTCTTTCTTGGAGCTAGCGTGAATGTCAAAAATGTTGCTGCGTCCTAGGGAATCTCGGGCTTATA
CTGCTTCTAATAACTATGTAGTACCGGTACTTGCCGCCGCAGTGATCCGGAGTCATCGTCATCTGAAGCTTCTGAAGCTAGACGGCGGCCTCGTCATACA
ATGCGCCTTCACGCCCCCGAGATCGTCGTCATACCTCAGCATGCCATCACGGGGGAGGTTGCAGTGAGGGTAGAATCCAATGTTGCGGAGCTACTAACTG
GCAGCTTACACTGCCAACGATGTGTCCTGCACGCTACATTTTGTTTGTTGGGTTCACAAGAGACGGCAAAATGGACTACATACATGTAATCGAGGTAGCC
GCCATTCGGCAAAAGACCGAGATATCCTGGTAGAGTGTTATACAAGTGGTGAACTTTCGAAGTGTGCACTCCATCCGTAGTTCAACACGATGCTGGCTGT
GGGACTCAAGTCGGGATCAATGTCACCAACGCCGTGAATCATTTTATCGACTACCGCATTCGTTGAAAAGCTGGACCCCCCATTTTTCATCGAAAAGCTG
GACCCCCGTCTCGGTTTTCCTATATAACGAAAAACGCCAATTTGTATACCGCATACTATTGAATTGAACACTTGTCAAATTTAGAAAAATATACAAATAG
GAGGGTATACTACCAAAGTAGCTCCGACGCATACAAGTCTGGATATTTTGTATACTGTAGAGCTAGCTACGTTCTGCAAACCCTCTTTGATGACACCCTG
GCAATGTATGTACCAGTCTTCAAACCATGGAGACATCCATAGGTTGCGCAGAGTTGGTTCACAACGCCTGTCATGCCGTTAGATGTAAGCAGAACTTAGA
CCAACAACCAAAACTATTTTGCTTTGGGTGCCTTGCGGTAATTTTGCGTAAAGTTCCAAAAATTGCAAACAGCACTGAAGACAAGTGTCAGTTTTTAACC
CCAGTCTAAATTTGTCCTAGGAAAAAGGACCAAATTGGTTTTTGGTGTGGCGTACATAAGCCG