Description :
From Genome Similarity Track
Location :
contig_15:569635- 570934
Transcript NameFunction/comments
g3466.t1hypothetical protein

Sequence
1299 bases(100 bases per row)
GTTGCTAGGGAACGAGATGTTCCTCCAGTCGATCCCCTCGGCCATGTACACCTGTTGCTCGCGCACGAAGACGAACTCGTTGAACTGCGCCTGCAGCCGC
TCGTTCGCGTAGTTGATGCACAGCTGCTCGAACCCGTTGCGGTTCAAGCTCTCGAACCCGAAAATATCCAAAATCCCGATAGTCGCCAGCTCCTCGTCCT
CGTCCGAGATCGAAATATCCGAATCGTAATAATTGATCTCGTCACTCAGCCGACGCACGAGCCACGTGAACAGCCGCCCGTAGATGGATTTGGCCAGAGA
CCCGCAAATCTCCTTGGCCTGCTCCGGGTTCAACTTCAGCACCATCACCTCCATACCAGCTTTAATCTCCCGACTGCTCAGAATCGTCTCCAGTTCGTGT
ACATCCACGCCCAGGAGTTCGGCACATTTCTGCAAGTGAAACTTCGAGTCCGCTTTAACCGCAGTCACCTCCTCCTGGCCCTCAAAATTGACGTTGCCAA
GGTGCAACAGGGCCGCTAAAATCTTGAAAATATCCAGCTTTTCTCGTTCCCCGACCCCCGTATCTTCAAAAGCCCTGACCGTCTCCACGTACAATTGCGC
GTATTTGTCGGCCACTGCTCGTTTTTGCGCAAAACTCGGTCCGTACGAGTTGAGCAGCTCGTATTTGCCTCCTTTTTGCAGCCCCAGCGAGTGCAACAGC
TCCGCGTCCGCTCCTTCGAGCAGCTCATAGAAAATATGGAAGCTGCGCTCCTCTGGGTTTTGGTGCAAAAGCCGCACCTTCTCCAGCAGGTAGCTCACAA
TTTGCGCGCCAACGATCTCGTTCTTGTCCCCGAACTGGATTTTGATGAACTTGCCGAAGCGACTGGAATTGTCGTTGCGGATCGTTTGCGCGTTGCCGAA
ACTCTCGAGGATCGGGTTGGTCTGCAAAATGCGGCGCCCGATTTCGGTGTCCAGTGACGGGTCGCGCCCCACGTTGGTCAGGAATTGCATGAGGAATTTC
GTGCTCTCGGTTTTGCCGCTGCCACTCTCGCCGCTGACCAAGATGCTCTGATTTCTTCGCTCTTTGCGCAAAAGCCCGCCGAACGCTTTTGCACCAATTG
CGAAAATGTGCGGGGAAAGTCTCTCTGCCGCGCCGAAATCTTGTTTGTAGGCGTCCAATTGCGCCTGCGAATAGAGGTTCGGCAGCGGCTTAAGCGGGTT
GAGCGCAACTAAAATGTCGCCGATAGACGTGTAGATCTGATCTTGCGCGAAACGCTCGCTCAGCGCCTGCAAAAGCGCGGCCTCGTGTAAATGCTCGAG