Description :
From Genome Similarity Track
Location :
Scaffold_230:56946- 60371
Sequence
3425 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTGTACACCGTTGTTTTGCTAGATAACCGACAGCAGGCTCATATGCGCAGCCAGAGGAGTCAAACAATCGTGGATGCT
TCATTAATGTCTGCTTCTAGATGACAGGACCGACCAACGGCTCAGATTATACCAGAGAAAAAAATAAAAAGATTGCAGAGCAGGTCACAAAGTGATCTTG
ATGTAAGTGCACAATTACTCCTCCAGGACTGAATGCACGCTCACTCCACCAAAAAATCTTCTTGAGCGGGTTATCTTTAGTATAACGTAGATGCAGTCGA
AAAGGCACAACCACAATGTCAGATTCCTCGCGCAGCTGTCTCAATAAGAAGCACTGTTATGATTCAGGCACTATGGACGGCTTGCTCACAAACACTACAA
AAGTACGCGGTCGAGACTTCGACTGAGTCCAGTACTTGATATTCAGCGCCTAGCCCTTGATCATTGGGGGCGGATGGTGTTGCATTATAGCCTTGGCGAC
CAATAAGTACGCGAAGGTCCAATCTCTCGTATGCTTACGGCACCCCAGCACCAATTTCTTACTGCCCATGAGCGTGGAGATGGGTACGATAGGAACAACG
CCCCTTGCGCAATTGATTCTTGAAATCTTTCTGGATATATTTCATCCAGATCTCGACGCCTACGCATGCAAGGTCGCTCTTGTTGGATGCTAGCACAAAT
GCACGTCTCTCTATAATCACACGCTGTGCAATAGTAAGTCCAGGTGAATCCGATTAAGCTTGCTCATATCCAAGACGACCTGAGCCGAGTCGATAGCACG
GAAAGTATCACAACCTGAAAGGTTATCAATCTGATTATCATGACCACGCTTACTGTGTATCCGAATACCTGCCATATCCACGACCTTAATGGGACGCCCG
TGATATGACCATGGCATTTCTACCGAATTATTCGTCACTCCGATCCTAGAAAATGACAACTCACTATAGAGCGTAGTGCACCAAAGCAAATTCAGCGCTT
CATCACGTAATCAGGACCAGTAGTATCACGATCATTGCGCACAATCTTGTTGTGCAACGTCTAATTGCTGATATTCGGTCGACCAACAATCTTCATCTAA
ATAGTTCGCGGCTGAACACGAGCACAAAAATTAAAAGACCTCATCAGCAATTTGTCAGTGTACTTCACATCCATCTCCGACGACCTTTTTAAACACTCAA
CAATTGACTCGAAGATCTTTGCGTTTGCCAGCGACCTGTATTACGACCAAGACGCACTCGTCGCCACATGTAGCAAGGTGCTGTGTCGTGTTAAGAGAAC
TGGCAATCGCGTATGGCTGTGTTATTTCAAAAGGACTGACAATAGCTTGGTACTGAGCGTACACGTCTTCTGTATATAAAGGTGTTTAAAATCCTATGAT
ACCGTGTGGTGAAATATGTAGGCTCTACAGTGCAAAACAGGCTGAATGCTAGTATCTGCATAATGGAACTAGCGACTGGTTTTTTCAGGAGCCGACTGGT
CACGTGACAGGAGATGAGGTCGCTGAAACTGAGACATTCAATGAATCAGCCAATTAATAACACACTCAAGAGGTAAAAATGCCTTCACAAGTCGGTATTG
ACTAAAGTGAAGTCGGTGTGTATGCAGCAGGATCTAAATTTGCCTCTGTGTGTGATTTCAGGATACTTGGAGAGAAGTCATTCAGTTCTTAGCAAGTGCC
AGTAGTCATTTGCCTGTTGGGTGGGTGTACAAATGTTTCGGGCGAAGATCTGCGTTGAGATTGCTATATACGACTGAAAAGCTGTCGGTGCAACGGACGC
CGGATCTCAAGCTTGCAGCCTTCATTTTCGATGCGGAAATTGACGGCGAGTGCATCAATATGCATATTCGTAACCATTTTCGAATCAGCCGCTCCAAGAC
AGCTTCAGCAGGTGATTACAGCTGTATATTCTGTACTGCGGTTTGTAACTTGTGTAATGTTGCTACTGTAGGGTATCTCACACGGCGCAAAACGATTCAG
CTATTGTGCTGATGACCTGAGTATAGGTGCGCTGCTTCACGCAAGCTCGGCGTATATAAGTCGTTGTAGGACGATTTAGATGATTTTGAGGCCATGTGTG
GGGCTGTACGATTAAGGTCTAGTAATATGCGCCGTCGGTCGAATAGTGACCTCTTTCGTTCAAGATTGACTACAGTTTGCATCCTTCTACTGTTACTTGA
ACACATCATAGTTAACTTTGCCCTTATGTTGGTGCTTAATACATGTATGTCTGCCACCAACGTCTAGATGACGTAATTAATATGCTTTCGATGACATGTG
TATCATCCTGATGCGCTAATGTCAGGTTTTCAGTCAATAAAGATAAAAATTGGTGAGATAGATGTGCATATTTCACCGGACGTGATAGTTTACATATATC
CGTCACTGGCCCCAACATCAATTATCTCTTATAACATGAGCTTGTTTTATAATATAATATGCATATCGATAGAGCCTATCCTGTATCTGCTTTAGCCAAA
GTGCGAACTCTGCAACACTGACGGACCCAAAGGGCATCTACCGAATGTAATGGACTATCTGCAGAAAGCATTACATCTTGCCATTAATTTCATTTACGTG
CAACAGTGACATCTCAAATTTGCCGGGTATCGTGATGTATGGTAAGTAGGTCGACACATGTCCTTCATCATCCAGAAGTACGACTGGGCAGGAATAAAAG
CTTGCAGCCAGAAGTGCGCACTCTTGATCTTGAACACAGTTAATTAGAAGCACTGAATTGCTCTCATTTTTTGTCCAGCATAAACGATCCTCAAGCCGAA
CAGTGTTGCGAACAAATACTTGTTTCCATAAAGTGCTTCGTTGTTCAACGATTCGAAGGAGATCTTTCCGTACGGTATCACATTGAGATGTGGGGTCCAT
TCGTCTTCTCTGCCATTCAGGTGAAATGCGATGGCTTGGAATCCGCAGTGGCCGTCTGCAGGTACGTCAATTATGAGATTACGCCAAGAGAACCTCGTTT
GTGGTCGTTTCGCATTGGACAAGCACGCCTGTCGTGATTATCTTTGATCAGACCGCAATAACCACTATAAGGTTTCTTCGTCGCATACCAAATGCTGATA
AGTCATGCTTTGTAGAACTCTTTGATTTGCTTTTGGCACTGGACGGTCGTCCTTTCGGCATCACCACTAATGAATTCGAAAGCGAGGGCATCTTCCCTGC
ACTGAGCTCTTTAATTCGCATTAAGGCTATACCCTGTTGAGCGGGTGGCCATTCTACATAAACTTCTTCAAGATTCTAGAGTTGCTCTTTAAGGATCTCG
AGATTCTCAACACGCAGATTATCTA