Description :
From Genome Similarity Track
Location :
Scaffold_148:56946- 59135
Transcript NameFunction/comments
g14652.t1hypothetical protein

Sequence
2189 bases(100 bases per row)
CGGATGCCACGAGAAAGCCTCGTTGAACGCCGTCATGTTGGCCACGGGTGCTTCACGACGCATTCGAGTGTACATCTCGGGCGAGTCGTCCACGCGCACA
ACGTACTCGGCGCAATCCTGCAGACTGTCGAATCGGCCACAATCGATGAAGCTCTCGGGGTTAAACAACTCGGACACGGTCTTGGAATCGCCCCAGTACA
CGGGCACACTGCCCGCCAGAAAGGCATTCACCAGCTTCTCCGTCACGTAGCCCGCCGCGCGCGTGTTTTCAAAGGCGAGCACGAACTTGTACGGCGCATA
CCGGCGCACCGCGTCGTCATTGTAGAAAATGGCCAAACGGGATGCCATCTTCGTCTGGTCAGGAGGTCTCGACGACCCCGCACACTTTCCGAGGGCGTCT
ACAGGTCGAAGAGCATTCAGTGCGTCGTACATGAGCTCGCGGTCGCTTCGATCGCAGTGAGCGTACAAATATGCGCAGAACTTCGTCTTTGGAGACTCGG
TTTTCGTGTCCGAGGGAGACAAAAGCGACAACGGCCCGTGGTCTAGCCGCTCCGCGAAGGACGCACTTGCCATCGACAGGTGGATGTGCTTGGTCCGGTT
AGCGTTCGCTAGCGTCGAGATCAGCAGTACGCGTTCGTCGAGACCATCGGTGCTCCAGGCCTCACCTGACAGCATCACCAACTGCGTCGTTCTATCTGGT
TTTGTTGCACCAGATTTGTTGCGACTGCTGCTATCAACGCTTTTGGCGGTGCCGGCACTGTAGCGCTCGAAGTATTCTGCCACCATCTTCTGGCACGCGG
GTGCTCCTGCTGGATTGCATTTACCACCCAAGGGACTGAAGACAAACACGTCGGGAGAGATACCAAGGTATTTCTCCAGGAGGTTGGCTGGTATCACTAA
CATGGGACGCATTTGCGCCTCAAAAACGGAGGCGAAGAGGCATTCCAGCACAACGTGCGAGTATGACGCGCTAGGTGCATACGCAACGACCAGAGCGGAC
TTGGCCGGGTCTGCCTGGAAAAGATTATGCCGCCACAGCTCTCCTCGCGATAGGTCGATGGGTCTTTCTTGCTTGAGTTGGTGGTAGCAGTCTTGGATTT
TCGGCTGTACAGTTGTTGCGAAGTCGAAATAGCTGGCGTTTGCGACTGTGAACGGCAGGTGCTGCTTTGCCTCGAGAAAGAGAGACAAAAGGTAGGACGG
GAAGGTGTTTACTGATGAGATATATGAAATCTCGACCCCTGCATTGGTTGGAGCTGACAGCGTTGTCGTCACTTGCAAGTGTCCTGACGAGACGATTCTT
GTGTGGACATCAACCTGCAGTTGGTGCAATTCGTGGCTTGGGATAGGAATTGCGGAGATCATTTCCAGTTGAGAGGGGGATGTATAGTGATTCCACGTGA
GGCGGTCGAAGTCATGGCAAAACGCTTTGCCTCCAAGAAGGTTCGCGTGGATGATACGGACACCGAGTGGGGATAACTCTGCGAATGAGATTAAATTGTC
TCTGCAGGGCTGGAGAGTAAGATGCGAAAACTGTTGTGTGTTTTCCAGATGAACTTGCATCACTAGTAGCCACAGCCCGACGCTGACATCCTCCAGTCCA
TTCAAACTCCGCAGTCGCCAATGATTTCTTGAAAGAAAGCGAGCACAATCCATCGAAATCACGTAGTGAGGACCAAATGCATAGGGCAGAAGCTTGTTCA
TCGGATACTGATGCTTTGGCAAATAGTTCTGGTGCGATTCTTGACGAACAGGGGAAGAAATGCGAGTAAAGCTCGAGCCCCACGCTTGACCCATATACAT
CCGTTTCCTTGTCCCTTTTTGCTGAAGGAGTTGAATTAATTTATCCACTCGCAAGTAGATATCATCATCTGCGATCATCACGTACGGCGTTTGTGCGAAT
TCGGCCGCCGCAAGGTGGAAAAAAGCCACCACCTTCTCCGCCAAGAGTCCGTAGGAGTCTTCACACTCAAGCTCATCGGTCAGCAGGTCTCCGTACACTT
TCTTCTCCATATTGACTGCATCCTGCAAGTATCGCTGCTCACTCTCGTCGTGTACACCGAGCATGTTTGGGTTACAGCCCAGAAACACCACTTTCGCTCC
ATATTTCCTCGCGTCCTGTGCCCATGTATCTCGAATCGCTTGGCGACGAGCGAAGTTTGTCACCACGGCCGTCTTTATTCCAATCACCA