Description :
From Genome Similarity Track
Location :
Scaffold_126:56920- 58880
Transcript NameFunction/comments
Physo_158674PREDICTED: similar to solute carrier family 2 (facilitated glucose transporter), member 13

Sequence
1960 bases(100 bases per row)
GGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACA
TACTCAGCAGGGTGCGAGACTCCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGG
GAATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTC
CTCAGCCGGCATGGAGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTC
TGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCG
CGCTCGTCGTAAGACGGCGCGGCCTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCT
GCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGTGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACGCG
GCCATGGAGACTGCGAGCTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCA
AGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGCTCCCGGAGAAGACGAATCTTCTCTTGCTGCAGGGCCACCACCTGACTCGAGGCCCCAGCAT
ACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCG
TCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGCTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGC
AGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACG
TAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCATCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGC
GAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACG
TAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGACTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCG
GCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCAACTTCAACGTCGCCAAGAAAGAGTGGCTCTTT
CTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGTTCTCCAACAGCGCTGGCGCACCAGTGCCAG
GCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGGGCTGCCTGGTATACGCACCCGAGCTAGCAGCGTGGTATT
GCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGATGGCACCCTCCTCGTCCTCAGCCTCCGAGTCGATGAACAGCTTGGAGCTGGA
GCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCACC