Description :
From Genome Similarity Track
Location :
Scaffold_1203:5692- 7592
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1203-fgenesh-gene-0.0Phosphoglycerate kinase
Pytar_ATCC12531maker-par_contig_1203-snap-gene-0.8High mobility group protein 1.2

Sequence
1900 bases(100 bases per row)
AGGTCGCTGCGTTCCGCGCGAGCCTCAGCAAGCTCGGCGACGTGTTCGTGAACGACGCCTTTGGCACGGCCCACCGTGCGCACAGCTCTATGGTTGGCGT
GGACCTGCCGATCAAGGCTGCCGGCTTCTTGCTTGACAAGGAGCTTGTGTACTTTGCCAAGGCGCTGGACGCGCCCGAGCGCCCGTTTGTGTCGATTCTT
GGTGGCGCCAAGGTGGCTGACAAGATCCAGCTGATCATGAACATGCTGGACAAGGTCGACGAGATGGTGGTCGGCGGCGGCATGGCCTTCACGTTCAAGA
AGGTGATTAACAACATGGAGATTGGCGGCTCGCTCTACGACGAAGAAGGCGCCAAGATCGTCCAGGCCATCGTCGACAAGGCCCAGGAGAAGGGCGTGAA
GCTGCACCTGCCGACCGACTTTGTCATTGCGGACAAGTTTGCGGCCGACGCCGCGACCAAGATTGTGACCCAGGACGAAGGCATCCCTGCCGGCTGGATG
GGCCTCGACGTCGGTCCGGAGTCGCAGAAGGCCTTTGCCGCGGCGATTCTCAAGGCCAAGACCGTGGTCTGGAACGGCCCCATGGGCGTGTTCGAGTTTG
ATGCCTTTGGTACGTTGCGATTGTGTCTTGTTGGCAATGATTCGATGGCTGACTGACCCATGTCTCTGATTTCTCTCTGTCCAGCCCAGGGCACCAAGAC
CGTCATGGACGCCGTCGTCACGGCCACGACCACGGGCGCCACGACGATCATTGGCGGCGGCGACACGGCGACGTGCTGCGTCAAGTTCAACACGGAGGAC
AAGGTCAGCCACGTGAGCACGGGCGGCGGCGCCAGCCTCGAGCTGCTCGAGGGCAAGGTCCTCCCGGGTGTCGACGCGCTCTCGTCGGCGTAAGTGTGAT
TTGCGATCGTGTGAAAAGTGCCCATGCACAGGCCAGAAAAAAAAGGGCGAAATGGATTCGAGACAAACTCGCGATTGGATATGAATACGCTTTGTTTGTT
TGCTTACATAGATCCTATGCAGATATCTCGAGCCATCTCTGATCCAGAAAGAAGCGCCTTCGATACGAAAAGCTCAGGAAGGAGTCACGACAGAGTCGAC
GACGGTTTACATAATCTTGACAATGAGCTGGTTGAGGTTCACAGTCAGCTCAAACTTCGGTCGTCGAGTACGAGCCAGCATAGCCCATACTGTCGAACCC
AGTCATGGACGCATAGCTAGCGTAGTGTTGAGACTCGGCGAATTCGCGGTCGGCCTTGGTCTGGTTCCACTCCTCCATCTCGCGCTTGTAGCGGGCTCGG
TCTTCGCGCTCTTTCTCGACGAACGGGGCCTTCTGCGACTCGGTCGCCTTGCTCCAGGCCTCGCCGAGCTGCTTGGAGATATCCGTGTTCTTCATGTCTG
GATTCTCGCTCTTGATGCGCGATCGCATGACCTGGCTGTAGAAGAGAAACGCCGATGACGCGCGCTTCGGAGCGTCCGGGTGTTTCTTCGCGCGCTTGTT
GGGCACGCGCAGCGGGCCGTCGTACGAAGCCATCTCTTCCTCGTATCGCTGCTTGTCCTGCTCGGCCGCAATCTTCCACGGCTGCTTGTCTTCGTCGGCC
ATCTTGGCCCACGCATCGGCAATCGCGCGCATGATATCAGTGACCTTGGCGTCCGGCTCGAGCGTGGCCTTGATCTCATCCCGCTTCTCCATCGAGAAGA
GAATGTAGGGCGACTTGCCGCGCTTGGGCGCGCCGGGGGCCTTCTTCTGGAGGCGCTTGCGCTTCTTACCGGGCTTCACGGGCGGCAACCACGACGTGGC
CGCATGGTCGGCGGACGCGGCGAGGGGTTCCATGGATGGCGCGTGTTGGGGTGGAAGGTGTCCTTGAAGCTGCTTGGGAGCGGCGCGCTTGACCTCTTGT