Description :
From Genome Similarity Track
Location :
Scaffold_14:569191- 570320
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08537protein phosphatase 2C

Sequence
1129 bases(100 bases per row)
TGTCAATATAGGCCACAATGATCGTGGTGTCATCAATCACCTGCTCCTCCTTCATCCAACGGCGGTTTGCCTCCATGATAAGTAGATCTACCGCAACTTT
CGGATCCTGCTGTCCCATGGCCATCTCCATGCACTCCTCATTCGACATGAACTCCCACAACCCGTCTGTGGCTACAATGAGGCAGCGATCGTGTTCATCG
AGCCATCGAGTGGTGAATTCCGGCTCGGACAGCACACCAGCCGTGTGTGCGACGGCATCGCCCAATGAGCGCGACATAGCGAGACCTGGAACATCCATGT
GTCCAAGCCAGACACGAGGAGGACCGTCAATGCCGTCATCGTACTCTACAGCAAACACGCGACCTCCACTGGCAATAATGCGAGCCTTCTCATCCGGTCG
ATCGGGTTTGTGATCAATAGACAACTCCTGGCATCCCAGCGCGTCGGGACCTGAAGGTCCAAGCTGCTTAACGAAGCCTCGAGTGATCCGCGAGTCTCCG
ACGTTACCGACAACCACGAGGTTATCTCGAACGACCGATACTACTGCAGTCGTTCCACTGAACTCGGTATCAATGCTCGGATCGCGCAGGACAGCCTGTT
CCACTGAGCGTAGTGTATCCAAAATGGCCGTCTGTAGACTCTCAGCATCCTGGTTAATGTCTCCAGAGCGCGCGAATTTGTCGTGAGCGAAGAGCTCCAC
TGCAAACTTGTCGCGAATAGCACCTGACACGCCATCACCGGCTTCACCGTGTCCGTCAAATACACACAAGAGCAGCGACTGAGTGTTTTGGTCGTACTTG
ATGACCATTGCGTCCTGGTTCTTCTTGCGCGGATTGTATGGAGCGTACCCCTTCTTGGATAACCCGGCAAAGGCCACTACGGCGCAATTTCCGTCTGCCA
GAGCCTGCACGCTACTGTCCACGTCTTCGATGGTAGCCGCAGCCATCCCATCTACCAGCTTGTTGTCGCTTACTACCGACAGTCGACGACGTTGTAGTCC
AAGTGAATGGTCTCCTCCGGTCTGTGCCACCGGGACCTTGCCCGGTGTCTTGATGGAGATACCCTTAGGCGATGCCACGTTGGTGGCTGTGGCCTCCTGT
TGGCGGAGCTTGGCCAACGAGCCCATCTT