Description :
From Genome Similarity Track
Location :
Scaffold_6:56910- 59114
Sequence
2204 bases(100 bases per row)
AGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGATTGAGCATAACCCCTCCACTTGACGAGTAGCTGTCGCTTACCGCGACGCCGTTGCTCCTGGAGGA
TCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCAGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCCTTTCCAAAGCCACTCTC
GTCCAAGTGCCCCGACTGCGGGTCCGACACAGGGCACTTAGGTTGACCGCCTCCGTCAACATATCCTCGTGCTTGAGATTGCGTTTCGCCTTGGGACTGG
GGTGATGCTGCCGCCCAGGCCGGGAATTAGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGTTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGG
TGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGACCTTTCGCATGATCCGACGGATCGAGGCTCTGCTGCCACGTCCGGAGCCACCTGCGGCACACTC
CCAGACGTACGCATGTGGTGCGTACCCGGCGTACTCAACGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTACGGAGCCTCTCCGGCGTACGGTCTTGAC
CGCAGCCTTGCCGTTCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCGCGTCGACGTCTGTGACCGGCCCTCGCTCCGAGGAGCTGGGGCAAGGTGGGT
CTGCGAGTCAGCAACACCCTGCGGATCAAAGTACCGCTTAAGACGTCCAACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGCAGGTCGATGGTGTAC
GACGCACCATGTCTGGCCAGGACTGCAAATGGTCCGATGAAGCGATGCTTCAGCTTGTTGCTGCCGACAGATCTGACAGTGTCAAGACGTAGGTTCCTCG
TGTCTAGCAACACTAAGTCCCCCATCTTAAATATACTTAAGTTTCCTCTTCCATGTTTGTCGGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGC
ATCGCGGACCCTGCTGACAACGCTCAGCTTGGTATCCATAAAGAATTTCACTTATTTCCGCAGCGAAACGGGTCTCACATCCGAGACCTGGGAGGAAAGG
GCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCG
TGAACCCCGTGGACGCATGCACCGCGTCGTTGAGCGCAAACTCAGCAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAG
AGTGTCCTCGAGCACTCGATAGACGCGCTCTGTCTGGCCGTCTGTCTGCGGATGGTCCGCAGTAGACATCTGCAGACGAGCTCCCAGTAAAGAGAACAGC
GTTTTCCAGAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCATCTCTGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGA
TTTGTTCGCCCGTAACAGTGACGGGAACCGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGTCGTGTCCGTCGGC
GGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGTACAGGCAGGCTCTGGAGTGGAGCCGAGGAGTGCTCTGCGGGTTTGACC
CGCTGACATGTTTCCCATGTCTTAACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACGGAAAGGTCTTGTCGCGGC
CAAAGTGGCCGCTGGAGGCCGCGTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACTCGTGGAGGTTCATTGGGCTC
CTCCCGGTAATAGAGGAGGCCATCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGTCTTCGCGCTCGTTCCTGCCATA
AGGAACTTGACAATAGGCGCGACAGCCTCATCGTTCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACACAT
AGTCAGGACGCCGGGAGAGGACGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGC
CATC