Description :
From Genome Similarity Track
Location :
Scaffold_6:56909- 58933
Transcript NameFunction/comments
Aphas_H257_03960unconventional myosin putative

Sequence
2024 bases(100 bases per row)
TCAAGACGTACGACGTGCGTGACATCGCCAAGTTGGCAGGCGAGGTGTCTGCTACGGCCATGCCCATCTGCAACACGTTCAGCAAGCTCGGCGTTCCAGA
CATGTGCACCCTCAACCACTTGCATGAACCGGCCGTGCTCAAGAACCTGCAGCTCAGGCACAGTCTGTTCGTGCCATACACGTACACAGGGCAAATCTGC
ATTGCCGTGAACCCGTACAAGTGGCTCGACTTGTATCGAAAGGTCTGTTCACATCCGTTCGCATCCGTGCTGATCCACTGACTTGGTTGTTGGTGCGTAG
GACCTGTACGAAAAATACCTGGAGCTACCGCGCAATGATTTGGCGCCGCATCCGTTCGCGCTGTCGTCGAGCTCGTACATTGATATGCAGGAAAACGGCA
TCGAGCAGAGCATTTTGGTGAGTGGCGAGTCGGGGGCAGGCAAGACGGAGACGGTGAAGATCATGATGAACCACTTGGCGTCCATCTCTGGCGGCGGGGC
CCACGGGTCGTTGGTGATCGACCAAGTGCTCAAGTCGAATCCGCTGCTGGAAGCGTTCGGAAACGCCAAGACCAAGCGAAACGACAACAGCAGTCGGTTC
GGCAAGTTCGCCCAGCTCCAGTTCAACGCCGAGGGGCTGCTTGTGGGCGCCCGATGCGAAACGTACTTGCTCGAGAAGAGTCGCGTGGTGGGCCAGGCTG
TGGGGGAGCGCAACTACCACATTTTCTACCAAGTGTTTTCCCTTCCCCACGACGTCAAGAAGACGCTGTGCCTGGACGGGTCTGTCGGTGATTACGCGTA
TGTCATGGTGGGCGAAGGCTCCAAAGTCGACGACGTAGACGACTCGGAGTACTTGCAAGAAACCAAAGACGCTATGGACACGATCGGCATCGACTACCGC
GAACAGCAAGGCATTTTCGAGGTTGTGAGCGCGATTTTGAACCTCGGGGAGCTCGCGTTCAAGGCCGAGTCGAGTGACACGAGCTCCGTGTTGTCACTGG
ACCGGTTGCACGTGATTGCAAACTTGCTTCAAACTGACGGCGCGGCGCTCGAGCGGATCCTCACAAACCGAACGATGGCGGCGAGGGGGGAGACGTTTAC
GATCCCGCTGAGTGCCGACCAAGCGGCGGACCTGCGCGATGCGTTTGCCAAGGGCGTGTACTCGCAGCTGTTTGACTGGCTCGTGGCTAGGGTGAACAAT
GCCATCTGCAGCGCGACCCGCAATGTCAAGCACCACATTGGGCTGCTCGACATATTCGGGTTCGAGTCGTTCGACCACAACGGGTTTGAGCAGCTGTGCA
TCAACTACGCGAACGAGAAGCTGCAGCAAAAGTTCAACAGCGATATCTTCAAGACTGTGCAGACCGAGTACGTGGCCGAGGGCATTCCGTTGGAGCTCGT
GTCATTCGACGACAACCAGCCGATCCTGGACCTGATCGAGGGGCGCATGGGGCTCGTGGATCTGCTCAATGAGACGGGCGTGCTGGCCAAGGCGACGGAC
GCGGCGTTCGTTGGCAAGATCCACGAAGCATTCTCTACACACAAATCGTTTGAAAAGGTCCGCGCCAACCCGATGCAGTTCAAGGTTCGGCATTACGCCG
GCGACGTCACGTACAACGGTGACAACTTTCTCGACAAGAACAAGGACACGCTGCCGCCAGACATGCTCGAGCTGCTCGCGGCGAGCACGTCGCCGTTCGT
TCGCGACGTGTTTCCATCGCTTGACACTAAGAGTCACCAGAAGCCGGGGCGGCGCCAAGGCTTTCTCGTCGGCGCTACGATCGCCAATTCGTTCAGGAGG
CAGCTGGGGGAACTCATGGACCAGATTGCCAAGACCACGACGCAGTACGTCCGATGCATCAAACCCAACGCCAACAAGAGCGCCACCGAGTTTGACCGTC
AGATGGTCGTGGACCAGTTGCGGTGCGCCGGCGTCATCGCCGCCATCCGCATCAGTCGCGCGGCGTTCCCGAACCGGCTCTCCCTCGTCGAGTTTGCCAA
ACGGTTTGACGTGATCTGTCCGTC