Description :
From Genome Similarity Track
Location :
Scaffold_537:5690- 7061
Sequence
1371 bases(100 bases per row)
GCTTGTCATTCCAAACACACTTCGATTCGACATGTTGCATTACGCCCATGAAGACTATCAGGGAGGACACCAGGGTATCACCCGGACGCACGAAAAACTG
CATTCCGAGTTTTACTGGCCTGGGATGTATGCCGATGTGGAGCGTTTCGTGAAAGAATGTGTGGACTGTGCGAGTGGAAAAGGACGAACTCCGAACGCCG
GACCGTCGCCCGGGAACATTGAACCCAGAAGACCTTTCGAAGTGGTGTCCATGGATTTTGTCACACACCTGCCGAAGTCCGACCAAGGAAACACTTTTTT
GTTGTTATTCTAGGACACGTTTTTCGGATTCGTCATGTGTAAGCTGATGAGTTCAACGACGGCTCAAGATGTGGAGGAAGCATATACAGAATGTGTCTTC
CAGAGGTTCGGTGCGAGTTCGCTGCTCCGACGTGACCAGGATCCCCGCTTTATGAGCGAGGTATTCACTCAATTCCGGGAACTCCTGGGGAGTCCGCAGC
GTGTCACGCTAGCTTACCGTCCGCAAGACAATGGCCAACAAGAACACTCCGACCAAACGGTTGTTCGGAGCTTCAAGGCATACATTTCGGAAGCCGACCA
AAGAGACTGAGACGACCACGCGGAGAGGCTCGTGTTCGCTCTGAACACCTCGTTTGATGCCACTCTTTAAGACACCACGTTCTACATGGTGCATGGTTGG
GATGCTCAGGGGACGATCTCGGCGATGCTGGGACTGAAACCATCGAGCATCGCTGAGAGGACGGCGTATGAATGGAGACGCAAGCTTCAGCGAGACTATA
GTTATGCTCAGGCATGTGCTGAGGACTTGCCGAGAAAAGCGAAACGTCATCATTCGGAGGTCCAGACGGCTAAGTGACGTGAGCTGAGGGAGCAACTAAA
GGCAGGATTCGAGAAAGGAGACTCCGTTTGGTTATACATTCCGAAACTGCAGACTGGGTTGAGTCGGAAACTTGCTCACATGTGGCATTGTCTTTTCCGA
ATTGAGGAAGTACATGATGATTTCAGGATTAAGCTTAAGGTGAAAGACACGGGCTATCGTATGAACCCATGGGTCCACATAAGCTGTCTAAAACCATGCG
CACTCTTTCCGAGGAGACCAGTTGCCGAGATTGATGTGAGCGAGGATGGTGATTTTGATGCAGCTTTGCCCCCCGAAGACATTTGGGAACCTGACTCCGA
CCGAGGTGAATACGAAGTGGACAAGATTTTGGATCTTCGATGGTCGAAACGCACCCGCACGTCCAAACGGAGTCGGGAATACCAAGTCAAGTGGAAGTGC
TATCAGGGTCCGGAATGGCTTCCTGTGTCACAACTGAGTTGCGGCGCGTTGCTCTAAGAGTTTGATCAGGG