Description :
From Genome Similarity Track
Location :
contig_12:569- 6955
Transcript NameFunction/comments
g3116.t1hypothetical protein
g3117.t1hypothetical protein F441_18424, partial

Sequence
6386 bases(100 bases per row)
ATGTAACGGGGTTACACGTACCCGTTAGTGTATCGTACACGAATAGTGTGTTTCACACAAATGGTGTGCACACCCAAGTTGGTGTGTGTACACGAGACTT
AGGTTGGTGGCCTCACAGCCACCCGTCATGCATATTACTAGGCTCCACTATGGTAGATAGTGAGTGTTATACATTTACCCCACTGGCGGCCCTGCCGCGA
ATAACAACAATAAAAATCAGTTCACGTTTTGAAGTCTAGTGTCTATTAGCCTTATTTAAGGTATTAATAACTCTAGGAGTCTGTAGATCGCATATCTACA
GACTGTACTTGGTTCTGGTATAGAACCAAGGTTTACAACCGAACTAAGACTCTGAGAGTCTACGTCTTCCTCTGACGCAAGCTACGGCAGCCCCGCTGCA
CTTGGTAGCACTTGTAGTCAATCCTACACCTGAGTCTTACGACTGTCCCTCTGTGAGGATGGAGCAATTTGCCCACTTACCCCCGAACCAACAGGACGGG
CTTAAAAAGCTGATGTCCTTGTTGGGCCCGGAAGGTGTGGCTCATCTTGCTTCGCAAGGCCCCGACGCGATTAATGCGCGTCTGGAGGCGTTCTCGAGTT
ATGAGAATGCTCTGTTGGAACATCTACAACAGAAGATGACGGCTGTGACAGCGTCTACGACGCCCAAGCCGGCATCGGATGGAGCTCCACGAGCTAAGCC
GCTCATGGTGAGCGTGAAGACCTTTGAGGGCAAGGAAGGAGAGAATCTCCTGCTCTGGATTAGAGAGGTCGAGATGGCCATGGCGTCCGCCATACTCCAG
ACGGAGCAACAGCGCGTGGCGCTGGCCGTGTCCAAGCTGGTGGCCGGGCCCGGGAGTGGGCCCTAACGTGTGGCACGTCGGTGGACAGCGCGTTCCCATC
CTGGGAGCAGCTGAAGCTTCAGCTGTCGCGAGTGTTCTCGCCGCCTAACCAGGCCTATCGCGTGCGATCACGCTTCCTGGCTACCCGCCAAGGAAAGAAG
GAGTTGGTGGACTTCGTCCAAGAGTTACGAACTCTTATTGCCGGTATGGCTGCGGACCCTCTTCCGGAGGCGGTCACGGTGACCATCTTCATGGAAGGCC
TCCGCACTGGCGTGGCCAGAACGGAAGTATTCCGAGTTCACCCCACCTCTTTTGAAGAGGCAGTGAGCGTGGCGTTGAACGCCGAGTTCAACTTTAAGTC
GGCCCGAGCCGGGTGGGGAACGTCGCAGACGAACTCATCCGGAGCCGCCGGCTCCTCGGGTGGGCCCGAGCCGATGGATCTCAGCCATGCTGAAGACGAA
GAAGCTGAGCTTCTTGCTGCCGAGCAGCGCATCGGCATCCGCCGGTGCTTCGTGTGTGGGAGCACCCAGCACCTGCGACCAGGGTGCCCGCTGCGTAAGC
AGCGCCAGGCTCCGGCGAGCCGAAGCCCTGCTTCTTACCAGAAACCTGGTTCGTGGCGGGGAAACGTCAACGCTCAGTAGGCGCGGGGCGGCCTACTGGG
GAAGAACTAAGTTCTGTTGAGCCTCAGCAAGGAGGTCAGCAGGGCTTAGCCCCGAAGAGCACCGTGCTCTTTAACACGGAACGTGTATGCAAGCCGGGCT
TGCTGGTCGTTGAAGCGACCGTGAAGGGCTTTGATAAGCCGTGGACGATATTGATCGATTCGGGAGCGTCGGGCAATTATGCTCGACGCTCCACGATGGA
AGGAAGTCGGCAGTATGCCGAGGCGCTGGTAGCGCGTACGAGTGATATTATCACTGTCCGTCTCGCGACGGGAACCCGCGTTACGGTGCCCAAGGTTCCT
GTGAACCTTGGCGTGAAGTTTCTGGACTTCGATAGCGTTGAACGCTGTCTGGTCCTTGACCTGGATTCGAGATATGATCTCATCCTGGGCATGGCATGGC
TGGAACGCCATGAGCCATGGATTGATTGGAGGTCTAAGACCTTAGGCGCTACGCGGTTGCCTCCTGGTGAAGCTTTGGCGAGTCATGAACCCACCTCTGC
TAGGAAGCAAAAGCGCTATTGGCGCGAGCACTGGACCGAGACGGTCAACGTGCTGGACATCGGCGTGTCGGAGTTGATTGACACTCATGATGTCGTAGAC
AAGAGTCCCGAAGGGGCTGTACGTGGAGCGGCACGTAATCCGCTGAGCGGGACTCGTTGTGATAACGAGCCATCGCTGCAGGCCGCTGATGGCATGGTCG
GCAGAAAGCCGAGGCATCGTGGGCATAGCCCTGATGATGCGCGTGGAGCGGCACGTTATCCGCTGAGCGGTGAGCGCCGCGATGGCGGAGAATCGCTGCG
TGCCAACGATGGCGCGGTCGGCCACGAGCCGAGGCATCCTGGGCCCAGCCCTAACGATGCGTGTGGAGTGGCACATAACCCACTGGGTGGGGACTGCGAG
CTATGCAGCTCCTCGCCGGATGTCGAGTTTGACGTCGACGCTCCGATGAAGCAACAAGAGGTGGAAACACCTGAGGACACCTTTGGTGTGAATATGCAGG
CCTCCCCGAGGCGTATGGTCTCCGCGAGGAGACGGCAGCGACGCCGTGTGGCAGCTGCGAGACGCAAAGCGTCTGTTATGACACAGCAAGTGTCGGGGTG
GTGGATAGCGAACAGCTATATACACTCGTTAATGGAGTGACCGGCGAGGTCGCTGGCGACGTCAGCCTTGAGGCTGTTCCCGCCGCAGATGCTCTGCTAG
AGCTGGACGAAATGTCAATTGCCGAGTTCGGCGAGGCCTTAAAGGCGGGCGAATTAGCCGAGGTCGCTATTATACGACCTGAAGATGAGTTAAACTCGTC
GTCCCTTATGGACGAAACAGTCCTGGAGGACACGAAGCAGGCGCTTAGTGCGCGTAGTGGATCGGCGATCCTGAAGGATCCTTCAGATCCGTACTATCCC
TTGGTTAAGGAATACCAAGATGTCGTTTCCAACGATCCGCCTTCTGGCCTACCTCCAGATCGAGGCGTGCGTCATGAGATTGACCTGGTCCCTGGAACCA
AATACTGCGTAACAAGGCAGTGGCCCTTGCCAAGGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAACACGAGGCGGGCATGGTGCGCGAGAG
CAAGTCTCCGCACTCGACGCCGACATTCTGTGTCAGAAAGTCAAACGGCAAGTGGCGCATTGTCCACGCTTTCAATAAGCTCAATGCCGCCACCATTCCG
GCGCAGACGCCTATTCCTAGGAAGGATGTTCTCCAGAACAACATGGTTGGATGCACAGCATACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGTTGC
TCATGCGTGCGAGCGACATTCCGCTGACAGCGGTCAGCACCCCGAGCGGGATGCTCTGGGAGTGGTTGGTGATGCCCCAGGGGCTGTCGAACGCGCCCGC
GACGTTCAATCGTCTAGTGACGCAGCTCTTCCGGCCCCATCGGGCGTATGCACAGACATACTTCGACGACATTTTCGTCCACAGTCGTGCCGAGCACGGG
AAGTCAGATGTGGACAACCACATAGACCATTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGCTGTACGCTAACGCATCCAAATGCATCTTCGGTG
CTGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGCGGCCTTCGAGCGGATCCCTCTAAGGTCAAAGCCATTGTTGACTGGCCGGTTCCCAAGAA
CCAAAAAGACTTACGCAAGTGGCTTGGCCTCGCCAACTATTTGCATAAGTACAGCGAGAACTACGCTGATATGGCTCGGCCATTGTCCAATCTCCTTAAG
AAGGATGTGGAGTGGGCCTGGGACACCGAGCATCAAGTTGCCTTCGAGGCGGTTAAGGAGAGTCTCCTACACGCGCCGATCCTGGCGTTGCCAGACCCCG
ATCGTCCGTTTAGTGTCGTCTGTGACGCATCGGACTTTGCCATCGGTTGTGCACTGCTGCAAGCAGACACCGAAGGGCGTGAACGCGTAATTGCGTTTGA
GTCTCGCCAGCTTAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAGGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTTCACCTGCTA
GGCTCTAAGCCATTTGTCATCTTTACTGATCATGCGTCACTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAGAGGATGGCCCGCTGGCTCTCCTTCT
TTGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAACGGGTTAGCGGACGCGCTGTCCCGCAGACCCGACTATGAGTTATCTCATGTCAC
GACTGTGACGTCGTCCGTGACGGACTTGATCCGCGCTGCGTATGCGCGTGACGACATGTGTGTCGCTCTGCTACGTGCTCTTGGGAGCAAGGAGTTTGGA
GACTCGGACTGTAAGCTGTCGGCGCGCTTACGCGCGAGGCTGCATCGATATTCGCTCGATGATGGCCTGCTGTATTACAGCACCGATCCGGAGGATACTC
CACGTATTGTGGTCCCTCACGATGAGGATCTGAAATATCGTATCCTCTATGAGGCACACGACACTGCGCTTAGTGGCCACCTTGGTCGTGAAAAGACCTA
TGGCTCTGTGAGCCTCTCCTATTGGTGGCCCAAGCTTTACAAGTGGACGAGCACGTATGTGCGCACGTGTGAGACGTGTCAGCGGGTGAAGCCCTCACCG
CATGCGGCCGCGCCGCTGGCAAGCTTGCCTGTACCCTCTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTCGGCCTTCCGAAGGACTCGGATGGCA
ACACGGGCATCGTGGTCTTTGTCGACCGTTTGAGCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATTGATGGTAAAGGTACAGCCAAGCTGTTTAT
CGACCGGGTTTTCCGCCAGCACGGGCTGCCCGAGTCGATCGTCTCGGATAGAGACCCCCGTTTCACGGGTAAGTTCTGGTCGTCCGTCTTCAAGGTGCTG
GGCACCCGATTGGACATGTCCACAACGGATCATCCACAGACCGATGGTCAGACCGAGCGCGTTAATCGCGTCGTGGAGGACGTCCTCCGCAGCGTTTGCG
CCGAAACGCCCAAGCGTTGGAGCACCATGCTTCCACTCGTGGAGTTCGCATTGAATAATGCTGTTCATGCCTCCACAGGCTTTACCCCATTCTACGTGAA
TGGCCTCACCCACCCTCGCGTCCCGTTGACGCTACCACTCCGTGGTTCCGGGCTTGGTGGGGGAGAGATAGCCGGTCGGCTTGCTGATGTCAGCCCTCTC
ACTGTTCGTAAACAGGTTGACGAGTTTCTGTCAACGCGTCTGAGTGTCCTTCGACACGTACGTGACGCTATGGCTGAGAGCCAAGACCAACAAAAGGAAA
ACGCAGATGCCAGGGGCAGAGGTAACATTGAAAGTTACGCAGTCGGAGACTTGGTTTTATTAAACGCAAAAAACCTACCTACACATGCAGTTTCTGCGGT
CTTCAAGACGAAGCTGCGCCCACGCTTCATCGGACCTTTCAAAGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACC
CATCCGGTGTTTTATGTGGGCTTGCTCAAGCCGTACCGGGACCCGGCGCGGGTGAGCGCGGAGGCGCTGGCACCGGGACGTGCACAGGTGGCACAGCCAC
AGAACCCTGCTGAAGTCGCAGCAGAAGGTCGACTTGACCCTCCAGCCTCGCCAGACCTCGCTCAAGGTCGGAGACCCGGTTCGCCAGCGCAGCTGGGGCC
TCGAACCAGTCGACGCGCTCCCGGAGCTGATCAATCTCATGCCATGAGCGATCATAGGCGTTCTCGGCCTGATGGAGAGTCTCACGGAGACGTACGACCT
CCCGGCGCAGCGATCCCATCGCGTTCCAAGCGTCCTCAAGCTCCGAACGATGCACCCAGTGCAACTCAGCGTCCGCCACCGGCGTTGCTCGATGAGCAGG
GCAATCGCCACTTCCATGTGGAACGGATTGTGGCTCGGCGTCGCCGCCAAAATCAATACCAGTATCTGGTGAAGTGGCGAGGGTACCCCCACTCGCAGAA
CTCATGGGAGTTTGAGGTACCCCTCCGGCAAGACTGCCCTGACGTCGTGGACGCTTTTGATCGAAACGATCGACGGCGCCCTGGGGGCTCGCGACCGGCG
CGTCGGTCGCCACCCGCTTCCCGGCAGTAGGTCGGGGAGCGAGGGGGTCAACAGCTGAGCTCAAGCTTTGACCCTGGGCTGCTGCAGCCGACGATCCACC
TTGTGGAAGGTCTGCAGAGCTCGGAGGAGCATGTTGAGGAGCCCGCGCAGGGCGGGGCTGGAAGCCCGAAGGAAGTTGGCGTTTCG