Description :
From Genome Similarity Track
Location :
Scaffold_182:569- 3509
Transcript NameFunction/comments
Phyca_LT1534537808LOC100283716 putative
Phyca_LT1534557629protein kinase, putative

Sequence
2940 bases(100 bases per row)
acgtattttgtaacatctctacgcttcttctctgtattaggaacccgtctgcgctttaagaactcacgctccaagaagacgcaacaagccaaaaaggttc
catcgctcaagaaccgcatccgtggcctcgaacgctttctcagtcgcggggtatgttcaccaccattttgcataataacaattttagcctaaagatgact
ggatatttgtagggtctggctgatgccactcggagagcaaagaaggctgagctcaagcagctgaaggaagaggtgagtgggttnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaagttaaaaagcccat
atcggtagctaaagcggaaatgatgttattgttacacagcacgagcaaaaggagaaggttgtcgcggagaaaaagaatgctgagaagtacaagagagtga
gtgctactggttctggtacttgctaaaagaccactaactgaaactatgattctacttgctagccgcgctttttcgagcgtgtcaaggttatgcgtaaact
gcgtcaggctaagaatcgcattgaacaggtggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatgatgtacatctactactaccccaagactgagccgtacattgcgct
ttttccgtctgcaccccactcggaagagaaccagaagcgtcaaaaggaacttcgcgcagaagctattgcttcttttgagaaggaacagcccacagaagcg
ttccaccagttttgcttcaacgacagcaagggtaaggattccaaatctaccaatgaagctaggcctgctgtggagctgttgctcaagaagcccacaaagg
agcaggtgaagaagcaagcgaagaagcctcgtagcaagcgcgacaagtctggtgaaaagccgaaacacaccccagctctcgttgaccaagatgacgacga
tgaaatgtcggatgcatcgaagagcgagagcgacaaagaggagcaaacagaagagcaggaagaagacgatttcttcctttgatcttggcattaatacgtc
gggtaaactgttcaccgctgttgtacttttgaaggccgtggttcttgaaatttattactaatagtctttacgctgacgagctcatatgggaaatggataa
cttggtcacaaaagaataaggctggcgaaagatgagtcgagctagatcaggatggatgggccgcccggagttattgtttcctgctctgcgtcagctatca
tctctgcttcagcttgagatgcagcagcaagagcattcatgtttgtaaagctgaaagatctgaaggcatctgaaaggttggaatcgtcggggctaccgta
catgccactagggaaccgaaagtgactgttgttgtcttccatctgcacaccgtcaaccacgcattcgtcatcnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaagcgctcgctgcatcgagtgcaccta
aagccccttcagtcccccacgacgagtccgggacatctatagcccctggtatcccccatgagatgtcaatatctgaggcggagactgaactgtcgttgtt
gttctcgtcattgtcatcctctcctttcgggtcagatgagcttagcgactggacatcgctctcaggtccagaatcaacgttctgactgctgcttgccgaa
cgagtagaaacgttgaactcatcgtcgtcaatgaaaatgtcggtaagatttcggttgttgaaatagctggtatcgttgggtccctcaagagtcggcacaa
acggaggcacagagtccaagatcgtgtcccaattgataccactgaagaaaggatgctgcttgatattctcccaacccatacgggacgccgggttcggatc
gagcagtttgtctatcaaatccactgcctcaagtgacaggcacttctcgccgtcgggccatagaatttggcgtgctataatgttctcgaagatggcgtcg
acagagtcatcattaaacggcggaaagccaaccagcatctcgtacaggatgattccaagtgcccaatagtccacaggggggccatgaggaactccaagaa
tgatttcaggtgccaggtagtcaggggttccgcatcgtccgaacgtttggtaagcagacttctttttcgagctcctagagattcgccgtggacgaatagg
tgggaaagcagaagtcatgtctcccagaacgtctggtatgccaggaggtatttcggggtcctgggccatggactcgtcatcgggttcagaatcggtgtca
ctaacagctacagcttcctcggacaagccgaaatccgtcagctacgaaaaaatacggcgactaagataaggatcgaggtagaaggaattatagtccagct
gagcgcaccttaatgtgtccggtggaagaaagcaaaatgttgtctggtttcagatctctgcaaattataaatccaaacgaggttggatgagttggtatgc
aaacaatgcaaccgaaacaagttaaagagcaatccaacctgtgaacacaactcttggcatgtaggtgattgagcgcgattgcaatctcagcgatatacac
gcatgccacctagcccaaaaagacatcggttatggatctgggtctacagccccagttgcatatatccagcttacctgttcttccagttgaacaatacact
ccaacagcgacataaaatcaccaccaggaagatactccat