Description :
From Genome Similarity Track
Location :
Scaffold_279:569- 3061
Sequence
2492 bases(100 bases per row)
ACCACATACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGGAGCCGCTCTGCGTACTCATCCCAATCCCTTTG
ATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGC
TGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCACTAAAATCTTCG
GAAAACACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAAC
AATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCACTCGGACATTCCCAGGTGACTCCC
CTTCGATCGTAGGTCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAATGGAAACATTCCCG
GATCCGTTGGTAGGTCCGACCAATGCCTTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCCGTTGCAAGGTTTCCGGCATCACCAAT
CTCATCAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATCCGTAGCGATAACGCTGT
AGGATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCATTCTGTGCTTTGAGGATCCG
CTCGATGCGAACTCTCTTCACGAATGTTTCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTGTCCTT
TTCCAGGATCCAACTACCACCACTTCGTCAAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCACTTCGACACCACATTGGTTCCGTA
AAGCGGCACTGGCCAAACTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTG
CCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCT
TGTCCCTTTAGTAGATCCAAACCCAGAAGGAGTCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCC
ATCTGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTG
TACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCG
GCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCCGCCCACTGTCCCAAACGTCCTTGCA
ACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTATAATTTAGATCCAACACGCGCAG
GAGCGCAAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAATGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCT
TGTACCAGAGCCGCTGAGACCGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATTC
TGTTCCTCAGTTCCATGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCT
CCATTGTTCCTGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGACGTCGTACCACTTGGATCCCTTCGTGGATCCGACATCTCCAGGGCCAGAGCT
TGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGA
ACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACATGTTCTTAGGATTCGC
CTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCATC