Description :
From Genome Similarity Track
Location :
Scaffold_2301:569- 2400
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2301-snap-gene-0.5Histone tail methylase containing SET domain (ISS)
Pytar_ATCC12531maker-par_contig_2301-snap-gene-0.3Conserved gene of unknown function

Sequence
1831 bases(100 bases per row)
AAAATTTCGTTCGTCACGAGCGTGTGGTTGAGGAACTGGCCCATGGGCGTGGCATTGTCGTCGGCGCGCGAGCACATGATCGCGTGCTGCTGCTCCCACG
CGGCCTTGCGGCACTTGTCCGAGCAGTAGAGCACGCCGCACTCGCACGTGACCTTGTGCTTGGCGAGGCGGTAGACGTTAAANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTCGTCCGACTTGCCGCCTTGCTTTTGCAAAAAGTCGATCGCAGCCGTGAAGTCTTCAAATTTGGCGACGTCGTTCGCGCCGTCGTT
CGCGGCCTCGACGCGTTCCCACGCGTCCTTGCTGTTGATGAGCGAGACAAAGCAGTGCTCGCAGCAATCGGCAAAGTCCTTGTTGTCTTCGTGCTGCATG
GCCACAAACGGCGGCTCGCTCCAGATCGGGTGCCCAGCCTTGATCGCGCGCACCGCAAAGATCGCCTTGCCCTTTTGCTCGCTCGCGACGCCGCACGCAA
TCGGCGGCGCGCCCAGCTGCTTGAGCTGCGCGTCAAAGTACTCCTGCACCACGGGCTCGTTGGGTTGCGGCATTTCTTTTTCTGAAGAGTTCCAAAGATC
GGGTGAAGTTTTGGAGTGACGAGAACGTAGGGAGGAGGAGAGGAAGGCGACGTGTCACGCGTGGCTAAGAAAGTGAAGTGACTGCGGGTTCCAGAATGCG
AATGCCACCGACGGAAGGAGGAGGAATCGAAGGAAGAAATTTGTCGCGGGGCGAGATGGGCTGGTGAGAGGAAGGCTCCACAGGCCGAATGGCCAATCCG
ACCGTTCAAATCTCCGACACACCAGCGGCACATCACATGGCCAATCCATTGATGGGGAAATGGAGGGGGGAGAGGGCCAGAGTGATGGTCAAAAGAGACC
GAAACGACCAGCTCCAATATTGGTTGGCTGGGAAAGTATCCATTTCAGCCAATGAGCATGGCTACATTTCACTAGTCCCCTTTGATACAGGATAGGACCT
GTGGTAATGCATAGATCGCTTTTGTCCGATCTTGAAAAGACGCGATGTGGAGACGCGAAATAAAAGATCGCAAATCCTGGGGGATGACGTGGAGGCTGCT
GGGGGTCGCTTGGGTGGCGCTCGTGGCCCTCGTGAGAAAAGCACGAGTGGATGCGGCGACGACCGCGGCGATTGGCGATGTGGATAATGCGAACTGTGCA
CTGTGCGCAGGCCTCCAGTATTGCTCGGTATTGAATGGCAAGCTGCTCTACGATCCTGTCATTGGCTACACACGGTACGTCGGTGCGTACTGTGCTTCCC
ATAGTGAACCCAAGGTGGCTGAGCACGTTTCTATGAATATGTTCTGTAGGGAGGCGACGTCGCAGTTGGAAAAGCAGGGTGTGTGTGAGGACCTGGACGC
CAAGACGCTGGCGCTGAGCCAGTTTGGCGATCAGTTCCAGTTCAAGGACACGGCACGGTGCCACACGCTTGTGTGGACATACCACTGCCTCTCACTCGCA
GCGACGACCCATCGCCGCGTGGTCAATGGCGTCGCTGTCTCCTGCAACAACGCCGCGTCGGCGACCTCCGCCAGCAAGCCACTGCCACCGTGTCGCTCGC
TGTGCGTCGAGGTCGCGGACAAGTGCGTCTATTCGCACTTGTCCCGCGACTACTTGGAGAATGTGTGTGGCAACGTGCCCTGCGTGAGCGAAGAGCAAGA
GGCCGCGTCGAACGGCTCGCTCAAGCAGGCGTCGTGCGTCCAAGCCCCATGGGAGATCGTCCCCAACACGACCTTCTCGCGATGTTCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN