Description :
From Genome Similarity Track
Location :
Scaffold_551:5689- 7165
Sequence
1476 bases(100 bases per row)
TATGCCCACTCTGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAAAAGCGGCGGCAGCTTCATA
AGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATACACTCCGTACCCGCGCTCATCGTGATCGCTGGAAGCCGCGCGCTTCAGGATGTCC
CTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCATCTGATCTTCATGGAGTTCCCGTA
ACTCTGTGGGTGAATACTTAAGAGTCTCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGCCAGTTCTCGGGCATAACCCAGGGGTATCC
CCAAAGAGGATAGAGCCCACCCCGGTTCTCGGGCTTCTTACGACAAGTCGTAAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCA
GCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGTCCGCCCACAAGATCACGAGGAGCGACGA
GAAGCTCTAGGAAGAGGTCAGCCCCACAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGATCCCTGGCTGACGGGTGTTACTACCCAACC
CCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAGGTCATTCGTGACCTCCCGGGGCTCAGAGATAGCACCCTCCTCCTCCTTTTTT
TCCTCCTTCTCCTCCTCTTCATCCCAGGAGTCGAAGATGCCCCGATGGGAGTGCCAAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCT
TCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCATC
GGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTCATAGCGCACAGACGTTCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTG
TCATCTTTGTGCTCACTGGGCACTGGGCTGTGCGCCCCCCCCCCCCTTAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCATCGTCCTCACTG
CCAGAGTTGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAGGCCGAGGGCGACGGACTGCGGCGCTTGCTTGATCGCTTGCCCACAGCCG
CGTCACCCGAGGAACCGATCGCCTCAGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTAGC
GGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAACGGTCGAATTGGAGACC