Description :
From Genome Similarity Track
Location :
scaffold_27:568816- 584741
Transcript NameFunction/comments
Plaha_PHALS_09482hypothetical protein L917_16699
Plaha_PHALS_09483dynein assembly factor axonemal
Plaha_PHALS_09484hypothetical protein
Plaha_PHALS_09485TRANSPOSON TY4-H GAG POLYPROTEIN-RELATED

Sequence
15925 bases(100 bases per row)
CCACCAGTGTGATACCAAGTCCGTGCATTGACACATCAATCACAGTATTAGTAAGCCAGTCATTAACGAATGGACGCTGTCGGACttctgaatatatttt
ggtATCTCCCAAGGCAAAGACTCGTGTCGAATTATCAATGTACACTTCACCAAAAAGGCCCTGAGGCGCATGCTTTACTTCTCCAATTTGCATAAAATTT
ACTGTCGTTGGAACCTTCCAGTGGGTTGCGGTCACACGCAGTTCTAAGTCTCCATTTGGATCTTCCCAAGCAAATGTATGGCTTTCCAATGGTCCCAAAA
CGATttcctctgctgtctttaccCCATATTGAACGTAGCGAAATGAGTAACGCGTCGAACGATTTTCAATGCGATAATTTGGGTTTGCTGAAATATCTCT
AACTGTAGCaaaaattgtctctgatgtcTCATGCAAGCTGACGCTGCAAACAGGACCATCACCTAAGCATCCGCGAGTCCAGAACACCATGTCTTCTGAC
ATGTTGTAAACTACGTTTGGGTCACTGAGCTTCGAAGCTAGCTTAAATAGCGGTATATTTGGACTCCAATCGCCCAAGTCTTGGGCATCATTTGCCATGT
CACGAATACGCAAACCAGCGACGTATTTCTCCGGGCCTCTAAAGCGATAAATCACAACTGCCTCACCTTCTTTCAGGGTGCAATTAGTCTCCTTAGATCG
ACCCCTGCCACGGTTGCCCTTCTTGTCCAATATAATCGGGGTCATCTGTAGTTTTCGCGGCACAGTACTTAAGACCACAAATCGTGGAGAAATCACGAGA
ATTTTCGACCGGAAAAACTGTGCTGGTGCCGCCTGGATTTCAAATGCAAGTACAAAAGAATAATTTCCAGATCCGTTAGGGCGAAGCTCTCCCTTTCTGC
CCACGGCTGACAAGTCTTCGGCCTCAGACCAACCCAAGTCTTCAAAGTTTGGCAGATACTTTTTGATCATTCCAGAGACTAAGGATTCGCCTTCATACAT
ATAAGGTGTTTCTTGATATGGACATACGCTAATAAGAGCCTTATCAGGCGGTGCGGTAACCATCAAAGGAATCTCCTTGGCATCAGGAAAGAAAGCACGA
TGCTGCTCCACGGTACACGAGCGTCCCCGTTGCAACTTGAAGCGTAGATCCAATCcacttcgattttgaaccCAGAACGGTGAGTAAAAAAAAACAGAGC
GAGCAGCATTCTCCTCCCACTGCGGGTGAAAAATGAAACTTGGACCATCATCAAATTGCAGCTCGAACTCGTTCTCATTGAATGCATGACGATCAGTCTC
AAGATGCAATAAGAATGGTGTGCTCCAAGTCGCAGCACGATTTGTCTCACTAGCACAGAGTCGCATTATCATCAAAGCGGGTTTGCTCAGATCCAGACCG
AAAACTTGAACAGTTTTGCCGCTTTCAATCCACATTTTGCGACAGTTGATTTCGTTCACGAATCGAAAGTAATCGATAGAGCCCAGAACCCTCACAGATC
GCGATTTCTTGTCCTTATCAGGGTCGTCAACAAGGCGAAACGTCCCCATACTTGTAAGTGTATCAGGTGGGCAATCATCAggctgaacaattgcgtatTC
AACACTGCAAGGCAAAACATTGTGGAGCACCAATTGCGGCTGAATCGTCAGTGACCAGGTTCCTAAGCGAGATTCATTGGCAGAAATTGTTTCGATTACG
ACAGTTGGCTGATTGTCTATACAACTCGATGATGGGTAAACCACTTCTTTACCAACAGGCATGAACTCGTTTGGGTCGGGAAGGGCGGCATTTGTACCCA
ACTTTTCTTTCACACGTTTCGTAGATGATACTGCGCTATTACTTTCACCTCGCAAAGCCTTTTTGGCCTCTAGCTGCTCAAATCTTGTCAACTGTTTGAA
TAACCGCTGATTCGAGACGGATAATTCTAACTTGTTGCTCCAGTCTGTTTCCCCCCTCTGACGAATGGCGAAGTACCCAGCTCCAACCAGGTCCAGAGGA
ATACTAATCGTAGCAAGAGCCGAAAGCATATAAAAGTATTGTCCACACTCTTGCTTTGGATTACAAGCTGCTATATCCCCTTGGTTGTTGTACATGAGCA
GCTCCGTATCCTTCACAGTTCCATTGCGAATACTTTCGCCACCGGAAATTTTCACTTGCAGACCATAAAAACCGTCGACGGATATATGAATTGCAGCTAG
CACAGGGACATACTGGCGCATGCAGTCGGCGTAGTAAGAGTCAATCCATTCGTAATTAGGATCGAGCTCCTTCACGCGAAGCAAGCAAGCGTACGCTTTC
TGCAGCTCGTGGCGTGTCAGCTTTTCTATTTTCGTCAAAAGAGCCACTCCAAGGTCGTACAACACTGCAATCGAGTTCTCAGATTCGACATCTTCAAAAA
ATGGTGTCAACTCAAATACTTGAGTTTGGCCAATCGACATCAACGGAATATCTTGAATCGTCCGGTAGCCTTCGATTTCAACAGTGAGGTAGCGCTCAAC
TTTCGCTCTCGACTTCGTTATTGCGCTTTTGAACTCTTCCCACGAAACCTGTCCAGATTTGTCCGTGTCAGCCAGCGCGATGAAGTCTTCTACAGCTTTG
GCAAAGTCCACCTCACTTTCCATAACGCTGCTACTAGTGCGTCTGGGTAAAGATGAAGCTCCTGATCCTGACGTTCTTCGTTGTTTGTCTTCCTCTTCAT
AAACGCTTTGAAGCACAGCACGCACTTCCTCTGTATCTAATTCTCCACTTCCATCATGATCAGCACTTCTGAAAGCTTGACGAAGCTGCTTCTCCTTTAA
ATTTTGTTGCTCGTGTTCTTCTGCCTCACAGCTACTCAAAAGCTTACATGCATGTGCCCCACCAGATGGAACAGCAGTGACTGCTGTCACTATTTCTTCC
CGCACACACTCCTTTGCTACTTTCTTTGCCACCATGTAATATTTAACATTAACTCCACTTTCATTTAACATCCAAAAAATAGCGCCAATTTCTTTGACGT
GCGGACGTTCAGCTTCAGCACGATTTTCTACCTTCGAGAAAGCGGCCATGTTTGAATTTACCGCTTCCATGAAAGCATGAGTTATGTTCAATTGAAAATA
ATGATCTGACGAGTAAATGATTGTACATGGAGCACCGGGCTCTTTTCTTACATCCAAAATACCTTGGTAAAACTCTAGACATGGTTCGACTTGACGCGCT
TTAGTATTGTAATAATTGCCGTAAAGATCAAAAGTAATTTTGGCTATTCCAAAACTGTTCCCACATCGCTCTTGTTCCCTAGAATCAATCACAGAGCCAG
ACGATTCGCCCTCCCATATCGAGAAATTCGCGTAAACGCCCAGTTCTTCCAAACACATCTCGATTGCTGGTATTCCCATGGGCAACATGTCGTCAATAAG
TCGCAAGTAGAATCCACCAAACGATGTAAATAGAACGGTTTGAACAAAAGTCTGCTGTTCACGTGATCCAGGGTTCACAATTTGATCGTGGCAATCTTTA
TTCAGACTTGACAGCAACTGATCAATCACGTCTCCTCGGCCTCCCATGTCCATCTCCATACTAAGCAACCAAGGGCTCTGCTCAGACGGTTTAATCAAAG
ACGGGTTTATAATTCGATTCCACGCCTCCTGAGCATACTCGTAATTTTCGAATGCACGAACCATTTTTTTCTGGACGATAATTGGTCTCTGTCCCATCAA
CGATGACTTTGTAGCACCAATTTGATCCTCGTAGCGCTCCCAAAAGGAAACAAGAGCTGCAGCATTTGCAAGTGTGTTCGCCTTGGACCCTGAAATGTAA
GGCACTTTATTCCTTTGCATATCGGGGTGGACGTACTCTTGGCCAGTGAGAGCAACCACTTTCTGGTGAAGACGCGGATACAATATTTTGTTTCTGCTCA
GAGCACtttcaaattcttcaagGGACACGTCTCCACTACCATCACAGTCTACAATGTTGACAAAGTCTGCTACGGTTGCATTAAATTCACTCTTTGTCAG
GTTGCCACAGTCAGTCGCACTTCGCAGTAGGTCGCCAATCTCCGACACATCCAACGTcccgccaccgtcggtgtcACGCAGCTTAAATTCCTTCTTGAGT
CGATCCATGTAGCGGTTCTCTTCAACAACACGCCTTGCTTCCTTCATTCGGGCTTCGCTCTCTTCTCGCTCCGTAATGACTTCAATATCCTCCTTCATCG
CTTCAGTGAGCGATGCCATAATGCTTAAAATGATGCTTAAGTCAGTCGGAGACAGATTCATCGCAAAGTCAGACATTTGCATTGTCAGCTTCCGACGGGC
ACCAGCTTTTTTGCGATCCCTGCTACTAGAGTTCATATCAATTTCTGCATGATCGACTTCAATTACTTGTTGGTTCGAAGCAGCTTTGCGAGCAACATTC
CACATGCTCTTCGCGGTCTTAATAGCACTTTCCGACGCTTTGATACCGCTTATAGACGAGTCTTTATTCGGGTCACCCACAGCAACTCGATAACCCATTG
AGAAATCAACACCTTCACCCTCAATTTCTAAAATGGTCCTCAAATCACCAATGTCTAGATCAATGCTGTCGTCGCGAAGAATAATCGTACAAGGAGTCAA
AGCAACGTCCACCAGCTCGAGCTCTACGGCCTCCGAGCGCTCCGATCCTAGGACTCGAAGATTAGTGTCAGCAGTAAAGGCCAAGACAGGCGTTTTGAGC
GTCTTGGAATCTCCAACAAGACAGAATTCACAGCCATGAAAAACAATGCTACATCCAAGCGGCATTCCACCAAGCAGTAAAGGCGAATAAGATTTTGGAA
TATCTTCCTCATATATGTTGATTGCGGCATCTCGCGATTCCGGTGAATCCATGCTATTTGCCTTCTCACACGCAATAAAGCGCATTTGTTCCGCTTCATT
TTCACCAATTGCAGGCAAAAATTGATGCACTAAGTACAACAACGGATCAAACACAATTAACAGCGAAAAATCCTTAAAAGTCAGTTCGAGGTCCATGTGA
CCGTCCCCTCGCTGCGAAACAGCAACAGTCATCATTCTTTTCGCGtccggattgcgatccaatATCTGACGAAATACATTTGTCGGAGCGTCGCGATTAT
CCACCAAGCCAAAACGCATAACATCTAGCGCTATTTCAACAGCAGTATCCTTTTTGTCAATCGTTGTCATTCGATAGCGTAATTCACAGCTTACATCTTG
CACAAAAACAGTCATCAGCTTGTTCTCATTATTTTCAATTATTTGAATGTTCAGTCTTTTCATCTTGAAGGACATTCGGAATAAATGGAATAATGATGGA
GACTCCGGCAGCTTTTCTTTGTCCACGTAATGATCAACCGGATTTCTCGCAAAATGACGTAAATTTCCTCTTTCTATATCTTCTTCACTCACGTATAACA
ACGGCGTGCCTGCATTTGGAATTTCCCAGCCGAGCGACAGTGAGCGCAAATAAAGGAGGCGCGTAGCAAGAACTTTCACTGCAAGCTCATCTAATCTAGC
CTTTCGCTTGTCAATGGAATCTTTTCGCTTGTATCCCTCGTACATCCGACGCAGTAAACTAGTCTCGTTATCGAGTTTCCACTGCTGACCGAAGAGCGAC
ATGTACTCCTCCGACTCGGTTGGGTCCAGCTCTAAGCATGCGAGGTCATCTTCGACGGTGACTGCCGTTTGCCAATCATAGTAATAATTTATTGGCTGCA
GCAATTTCAAGAGAATATTTACTTGAGCAGGACGCAGCTCAATTTCACAGTTTTGATCTCTTGCAAATAAAACTTCAAGTTCCAGAGCACGTTCCTTAGG
ACCTGATCCCATGACGAGCGATTGAAGTATAGAAGGCAAGCAAACGCCAATCTCCAGCGTAAGCGGAGCAATTAAATGACAAGCATTCAAGTTGCATCCA
GGCTTCGGATTAAGATACATTCCAAAATTCACCAATCGCATACTGCGCTTACGTGGGATTTTACTAGTCGGAGCGCTCTGACCCATCTCGAAACCCTCTA
TCGCAATTCCTAAAGTGGCCCCGGAGTATTCATCGCAAACGACAAGCGAAAACGACTGCAACGCAAACTCAAATGAGTCTAGCAGCTTGTCTACCCAGAC
GTGCCAGAACGCAGGCTTCTCTGCCGCCTCAGCTCTgacattttttattctttgAGCCTGCAATTTCTCCACATTACGAATTTGCTCGCGAAGAGACGCA
AGATCCTTCAGTTTTTGAACAATTGTAGCCGTCCAGGCATTAACGCGCGCTATTCGTGCCTGAACCGCCTCTTCGACTGCGTCTTTCCGGCGCCTTGCGT
TCTCATCGCGGTGCCACATCCACTTCTCAGCGGCGTCGAGAGTCAGACCAAGGCGCAGGCCGTCAATTAAAACTTTGGACTTAGTGAGCGCATGGTCTGA
ATTTACGAGCTGACCGGTTGCTAACCGTACAAGGGGTCCCCAGAAAGGTGCAATTAGGAGAAGGCGCTTCATCTTCAAACATTCAAAGCCAAGAGGTAGC
CCGACCAGTGATTCCAGCTTGGGCATTACATGATTGTCCAATACTAGATCGCGTACCTCTAATGATCCATCACGCAGCGACCAGACGATGCAAAAGCTTT
TTCCCACGACCGAAGCCGAAAAAAAACGAAACAGCCGCGTCAGAAAGATATCGCCGAACGCCAAGAAAGCTACGAGCGAGCACAGTAGCAGCGTAAGCAC
TACCATCCACATAGTGTTGCGCTAACGAGAGAGATTGGGTATTTGATAGTTAGTCGGTTAGTTGTACGAGTGAACGATCTTAAAGTGCTGGCAAATTAAT
CGATTTGTGGCGGCTGTGGATTGATAAATGCACAGAGCGACAGGCGACGTAGCAACCAACTGCCGTGACAATAATGTCCCACTTTTGATTAAGTCTCACA
CTTAATGATATTAACGACCTATCAAATAAACTCGTAGAATACTAGATTGTGATATTCAATCCAGCTCACACAAATTAGTATACAGCTCAACACCTTGTTG
TAGCCGACTATGTTCGTCTTGCTGCTGCGTCTTCCCTAAGTCAAGTAGAATTTCAGCGCGACTAAGGGCGCGGACGGGAATAGCGTTGTCGTTGTCACTT
TCTATTTGTGTTTGAACGATTTGCTCGCAGTCATGCTCCTGCTTTTTACCCACATTGATGAAACTATTGGTCATGTCTTTTTCAGTGAAAACTTTCTTAG
AAACTACGCACCCCAAAAGCTGACGGCAGCGAATGTGGACGCAGTTGGCAGGGCGTGGTGCTGGCACGCTGCTGCAGCTGGGCCCAGGTCTCACGCGGCT
CGACATCGGCTAAGCCGCGCTGAATCGAACGAAACAATGCTTTTGGCGGTGGAGGTGGAAGGTCCGGCTGTATTGACGGCTCCTCGGTGAACAAAGACAT
GGCGCAGGTGTCATGTCGTTCGCTACCTTCGCTACGTCCACTTAAATTCTGCTTTGCGGTATCGGTTGTCGTGCGTAACACTGAATTCTCGATCTTGCTT
TCGCGTACTCTCGTCATCTCTGCGACGGTATTAGTAGCTCGGGCAGCTTGCATTTCATCGCCGCTCAATAAAATGCTCTGCGCCACCTGATCAATCGGAA
AAGGGGTTCCAGTAACTTTCTCTTCGACCTCTACAGCTGTAATCGGGCTTTTCATACCAAGGGCGAGAAGTCTTGCTCCCTTCGACGTGGCCTCAGAAGC
CTTCAATACCTTGTTTTCACGCTTTGAGCGAAGTTCACCGCTCTTTTCATTCTCGAAGATTTGCGAATCTAAAGAAATAGCATGAGTTTGATTCAATTGT
GGTAAGGCTGAGGCTGACCAATATAAAGATTCTTTTGCCTTGTCCAGCGCTTTGCGAATTGTTTGCCCGCAGTCTGTGCGACTCTCCTTCATGCGGGCGT
CCGACTCGGCACATTCCTCTGCATTCTTCTCGGCCATAGATCGAGTGACCCCCAGATTCATAGACCTTGGTGTGGCTTGAAGCACTTTCTGCTCGCGCTC
CAGATCCAACCCTGTGCCATATCGCTCTCTCACTTGTGTCTGCCAGTCTCGAAATTCTTTTAAAGTGCTCCGTCGTTCTTCATTTCTTTGCTGTACAAAT
AAACTTTTGGCCTCGCGTTCCGCTTCAACTCCGCCAGTCTGCCACGCTGTAACAGATATACGTTCAATAGGAAAAATGGGACGGTCCAGAAATGACAGCT
CAGGCAGGGCTGCAATATATGTCTTTCGGAACGAGCGCGTGTTGGAAATTACTTGGTTGCCTGTAATTCTCAGCGCCTTGAGATTTGGCATTAATTTGAA
CACGCTTAAAACCTCTGGGTCAGCGATTAAGTTGTGGCTGATATCGATGTTGTTGAGCAGTGGACACTGAGCGAGCTCCTGCAAATCTGCTTTTGAGGTG
ATGCAATTGCGTGATGCATTAAGTGACAATAGATTTGGAAGATTTGCAACTCCCTTTAGTGACTGAATGCGATTTTCGCTCAGATCTAGCGTATTCAGAT
CTCGCAATGTGTTAAGATTCTCAATCCTTTCGATTAGATTTTTGCCAAGGTAGAGGCATCGCAGCATGGTAAGGTTCTCCAAGTTCTCAATTTTTGACAG
TCCATTTGATTCGAGCCAAAGGGCCTTCAAGCTACAATAGCGTTCTAGACCTTCGATGCGCTGAAACCCGCGGAAGTGCGCATATAAACTTTCGTTGAGC
TCCGGTGTTTCATATCCATCATTGGACACACACAACTCACGTAGCGTCTCGGCGTCCATAACAGGTACCTGGCCCTTTCGCTCTTTGAGAAAACGCCTTT
TTTCCAGCTTGCGCAACCGATCAAGTGGTAACATCTCATTTGTGGTTAGCATCTTGCGCCGGACGATAGAAGCAATGGGGCTACGGTAATGAATAGACGC
AGTTGTTTGAAGATCTTCTTGGCTAAatcatcaaaattaaaaataaCCTTTAAGATACCAGCTTTGCAAACTTTGTTGCTAGCAAAAACAATAAATCACG
AAAGCGGACTGCCAGAACAAAATGATAGGAATATTTCTTCTACATCCAGATTCTCCGTGAATTGCAAACGTAGCTCACTGATTATTATGTTTGCTGAGCA
GGTCGAATGATCAGGCATTTGACCCCTCTAAACAAAAATTTGGATATACATCAAAGCTGGAAGGGTAAGAGCTCAGATTGATGTAACGAGATCAAGGCCA
AACCCATGAAGGGAGAGATGGTGATATTTGCAAAATGTGATCACAGATTGCAACTGACAGTGTTAAGGGTGCAGATCCGCCACACAACGGTTTACATATG
GTACACTCCGCTTTATTAAAGAGTGACACGTCCATAGCAACCTAATTACCTCATTCAAATTCACTAAAAAGTGCTGCTTCAAAAATTAAAGGAAAAGGAA
AGAAGACACAAACTTCAAAATATAAAGCGACGAGCATCGCTCTTCATATTTGATTGACCCCGCCATCAGGGCCAATATATTGGGATTTCGAGTGAGTGAT
TGACCAAACAAACAAACACCATCTCAAGCTCAGTGAAGATAAAAAACGCCACCACAACACCATCGCAATggagttgccgtgcacttgcATCGAAGAAGTT
CTGTCTCTCAGAGTCCGCGTTGAACAAATGCACAGATGCTGTGTAACGGAgttgcacgtaccctgggaaaattcaatttcttgtcatgaatCTGCTTCGG
ACCTCGCACGCAAGAAACCGTNNNNNNNNNNCCTCAAGTCATATACGTTTCTGACGCTTCCGggcatgctacagcgttcctgataaTACCNNNNNNNNNN
AAAAGGGGGACGGGGGGCTGAGCCCTGAGTAGAGCTAGACTGATGGTCCGGTTAAGGGCAGTGAGGGATAAGTGATGGCGTCTGGTGGAGGCAGAGCGAC
GCACCCTAACaggagtgagtgagtgagtgagtgaaagAGTGAAGACACACGGAAGAGATGTCCAAGGCAACTCTCTCATCGTTGGACAAGCCTTACGTGT
GAGTTTCAAAGGTtctcaagaaaaatgtgcGCACAAGTATTGGTTTTTACACTTCCAATTTCGACATGGATtttggctcagtggtttagagTNNNNNNNN
NNATTATCTTCCGCGTAGCCAAGCAGGAATGCGACGATTGCGTTGTCGTGACGCTTCTGGCGCTCTGGCGAGACAGGGACGTGGACGTAGGCGAGTGAGC
CAAACTTACGNNNNNNNNNNTCAAATGTGCGCGATCCTACGTAAAATtatacttttcaaaaacgatATGCGAAAATGGGAGggtataaattttgaaaggt
taTTTGGGAGGCTTTTCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATACGAGACCTGTTAACAATTACCGAGTGTAGCCAT
TCTTGGTTCACCGTTACATTGAAGGCGTGTGCCATGGTGATGGAGGAACTCAAGCAGAAGAGATGGACTAACGGCAAGGAGGCTGTGCGAGCAATCAATG
ATGTCGCACTAGACACAAGGGAAGTGTGCAATCGTCATCAACAGAGGGGGGACGTTTCGTTTATACTTTCAACAAATCTTAATATTGGTCTAAAGCTTTT
ACGTACCACTGGTTGCAATAATGACGATCCTCAAGGACGATGAGCTCGAGATAAATTGGACATCAGGGGCTGTAGATCCTTCTGATAATGAGAGTACTAA
ATCTGCTGGTAGCGGGGACGAGTTCGAGGAAGAGACAGAGCTGGAATTGGTATCAGGCATCAAGCGTAGCCGCAAAGATGAAAAGGGCGAAATAATGAAC
AGTGGAGACGATAAGAACGTTGTCAAGAAGCAAAAGGCGAAAGAACAAGCTTACACATGACAACCATTTTTCAAGAGCTGGTATTGATGTAGTTGAATGT
CTTCTGGCAAAAGAACAATTTCAAAGGACTGTAATAAACGAAACGTCCCCCCTCTGTTGATGACGATTGCGCACTCCCTTGTGCTAGTGCGACATCTTTG
ATTGCTCGCACAGCCTCCTTGCCGTTAGTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTCACAGGCGTAAAACTTGCCAGTTGTACTTTGGCTGTAATTCGCTGTATCCTGCCCAAGATCCTTGCCCACGTGCGTGTTCCATTCA
CTGTCCACgtgttgagcaaaatgggtgAGTTCCTCTGCTTGCCGCAGGAAATCCTTCCTTGTAGGGTCATACTTCGCCATCAGCACCTGCTTTAACTCAG
GTCATGCGAACTTCACAATGTTCTCCAGTACTAGGTCGTCTCTTCCACCTGCCACGGCTGACACTGCTGTGAGGTATAAGTAATGTTCTGTCCATGATCT
GAAATTCTCCATTTTTGATGGTAAAATCTTTGTATCTTGGGCTGTTGATATCTTACATGCAAAAGCCTTGGTGAGTTGGTCAATGGCATGACCGAATGAG
GGATTTTCATCCCACCATTGATGGATTCTTCTCTGGAGGTAATCGGCTGCAGTGCCCTTCAGTTTGCTTCCTAACACATTAACCTTGATTTTCTCTGGCC
ATTCAAAGCCAGAGAGAGTGACAGCCATGTTGGCCTCTCCCATGAATTGCAAAGCCCAGAGCTCAAAGCCGGATCCTAAAACCCTTATAAGTCTCTTTTC
CCTCAAAAGGGGGTATCAAGAGCAtcctttgcttcaatgtAGAATTCCTTGGACCatattgttgctgttgatgctgtggtgggaatgcatgcatttCCTG
TGCCTCTTGATGCTCTCTATAAGCTTGGAACTGCTGTTCTCTCTGTCTCGTGTCATCGCGAGCGATTTGAACGTAGGACATACGGTGATCTCGTGCTCCC
AGAGCTGAACCACGTGATACTGGTATGTGAGGTTGGGATTGACTCTTGATGCGTTCAAGCATAACGCTCCTAAATGCTTCTACCGAAGCACTACCAAGTA
CGGAAGGCTGCTGATGACGTTGTCCGTTATCAGACCTAATTGATGCTACTTCTNNNNNNNNNNGGGCGCCTGTTGACACGGGACGTCCTGgtatttccga
tcaaaagcgtccacggcaactggacaatcttgccgaagtggcgccttgaactcccacgagttttcggagtcgggatatctccgccacttcaccagatatt
gggtttgaccccgttggcgacgtcgtctcactagacgtcccacgtgatagtggacgtcgccgttctcatcgagaagagtcggtggtgggCGGTGATTCTT
GATGCTCTTCGCGCCctggaggacaaggtccttcgtaatcggagctGCACTGAGCGTCGTGTTGATGGggtatatcgctgtgcggacgctcttgacgact
taaagcacgtcgtgcgcaggttgcctcgccttgaggactaccgcactCTGTCGGaacgactcctagccgtggagcaggcgaatgcattgctgcaggcaac
aatggagcgcttggcttcgTTGGAAATGGatgttgttgcactctgtgctcagaaccagttgctgattcagtttctgggtggccgcgggcccgtgggattc
gctccggcgccaacgcttccgcgctcactagcgccggatcccggtacggcttgagcaagcccacgtaaaacaccaggtgggtgcgcatccgtttcggaag
gttcagcgtgtacgccaggccccgtttggccacaaccttaaacgatccgataaaccgtagacgaagcttcgtctggaagatagcagaggctgcatgtgta
ggcaggttgtttgaattcaataaaaccaggtctccggccttaaagctttccactttgcctcttcttttttcgtctgaatattgtttctgcaggtcttggc
tttcagccatcgcatcgcgaacgttgtaagacactcagtttggtaggcaagaagtcatcgacttctttacgtaTGGTGagggagctgacatcagctagcc
gttcggctattacCCCCCtcccaagccctgagccatggggtgacggcgtcagcgggacgcaagagtgaatcagcccgttcacgtagaacggcgtgtagca
tgtagacgaatgcactgtattgttcagtgcaaactctacgagtggcaacatggcgctccNNNNNNNNNNCAAAAAATGATGATGCGCATATGAATTATAT
GACAAAATATTTAACCTTACTGAGCGAGACAGACAAACACACAATTGATGGGCTTATTGTTGATTTCAAAGCTGCTCGGAAATCGATGGGTGGGCCCGTG
CCTATAAACATGGTCTCTCCATTAGATATCAGCATGCTGGAACCCTATGATCGACTAGTTCTCTATTGCGCTCTGAAGCTCCGGTCAGAACCCGTAGATG
ACGTCAAGTGGTATACTATATCGCACTACTTGCTACGTTACGGATTTAATCGCATTGGAGTGACATTAATATTGCGTACTGCTAAGTACAAGAACGTGAA
ACACTTTTATGATTTATACGACAAGACCATGTGTTCAATGAAGACAACAGAGATTCTGAGTGTAAAGCCCTTAGACGCCGAAACTGATGTCTTGTCCCGT
AAAGCATGGATGTTCGCAACCAGAGCCAGAGTtagtaaaaaaattatggCTATCGACTGGGACGATTTTCTTCCCGTTTGGATCCACTCGAATAAAGATT
GGAGTGAGTTGAAAACAATCCTTGACATAACTTTTGTACCTGCGAGTAGAGTGACCGCAATTTGCAATCGCTTTAACGAAAAAAAACATCCGCAGCTGAG
AGGACAAAGCTCTTCACATAAGAAGTAACTTGCTCTAAAGGTCAGCTATTACATAATGCATTAGTTCGATTACTCATATGTTAACGTTGCTTCAAGGAAT
TTTAACGATAAATGTATCTGAGCTTTTTCGTAAAATATTTGTCATATAAAATGCTCCCAAGAGCACTGCTTGCGTCACGAACTCTCATACAACTTTTTAT
TTCATCTCACGTAAAAATTCACTTGCGAATGCGGTTCGAACATTAGCATAACCAGGCCTAGTCGTAAAATATTACTCCGAGTACTGTTCGAAAATTAGCA
TAACAGTACATACGATACTGTGTGTTCACAGCTGATGATTAACTCAAAGACATTGTGATAGCTACAAATCATTTTACGATTTTTTACGCAAAAAGCTATG
AATTGATGGCGAAACCGAAAGTGAAAAGATTATTATGGGGTAATTATTGCTGTTGAGAAGATCGTAAAAAACAAAGTGAATATCTTTCGGTCCTcagttc
gctactctgtgctatcTCTAAACCTTTTTTACTAGATCCTTCGGAAGGTTCTTAATGTAATCTTATTTATCTGGACAATTGAACGACTACCATgatgtcc
gtaatcagcatccgtaGTCAAGATAGTAATTGTAAACATGATCGTAATTATCGTGACGCCATCCGCATGCACTCAGCGGTGTAAACTTAACACTTCCACT
CACCGCTAAGGTTGAGTGTGCTTGATTGACTGATGCGATCGTAATTAGGCGTCTATCGCTTGTCGCCAATGTTCGGCTTCGTCACTGGCCATCGCCTGCC
CATACGTTGTAGGCAAGTCCGATTCTTCACCAACACTTACAGCGTAAGCGAGAACAGCTTTAGCTATAAGGCCGTCTTCATCAGTCCTTGCACGCATGAT
GATGGTCCCTCACCTTCTTCCAAACTTTCTTCGGCATCTGATCGTTGTCCAATAACAACTTTGGTTTGCATGTACGCCTTGAACGTTCAACTTGAGGTTG
AGTTACCAGTCGATTTTCCTGTGCATCAGTGTAGGAGTTCTGTATTCAGTCAGTTCAGAGCGTACTGATGGCGGTAATTGAAGAACCTCAACCCTTGATT
CACTTTTGTCGGGCTCTTCCTCATCCAATGAGGCATTtggaatctcttcttcttcttcacacTCCATAGactcatcttgatcttgttggTATTTTGTCGG
CCCGAACACTACGCTTTCATCGTTTGTCTCAATCACACGTATCAATTCTTTTTGTTTGGGCGGGTGCATCTCATAAATGCCGCCTACTTCACGCTCGTTC
AGCTTCGTCGACCGTGATACTGATACCTCGTCTTTCTCCAGGTCGTAAACTCGGTATACCTTGGTGTCTTTGGCATAACAAGGAAAGTTGCACTTAAAGC
GTTTGGCTTCGAGATTCCTTCTCTTCACTTGATCAACGTGAGCATAACCATGAGGGCTAAACACCAAAAGGTGATCCATCCAAGGCTTTATCATATATTT
CAGCTCATATGGGGTACACTCATATGGTGCTGCACTGTATTGGAGAGCGGTTGATTAGNNNNNNNNNNttgcgtttccctcctgagcGGAGCTAAAAATG
CAGCTCTTACAAGTGTGCTCAccacctaatcaggcatatcgcgtgcgatctcgATTCCTTGTCGCCCGTCAGGGCAAcagggaattggtggactttgttc
aagagatgcgcactctcattaccaggatggcagcagatacCCTTTCGGGGGCGGTCTCAGTGACCCTctatatggaaggcctccgcactagcgtggccag
aatgaaagtcttccgtgtgcattcg