Description :
From Genome Similarity Track
Location :
Scaffold_1235:5688- 6763
Transcript NameFunction/comments
Phypl_g12842hypothetical protein

Sequence
1075 bases(100 bases per row)
ACGGAGTACTCGCTTCGCCTTGGCATAATGGGTGTAGTCAAAGTTAGCAAGATGCGCGCCAAGCGTGCGCACAGCATGAGCAATGTCAAGCCGCGAGGCT
GACACCAGGTACTGCAATGCACCCACAAGCTCTCGGTACGGCAGCGGCTCGTCTTTGATCGGTTGCTTGATAGCGAGTTCTGTTGTGGACTCGGGAGTAC
GACACCCATTGCAATCGTTCATGTTGAAGCGTTTGGGAATCTCAATGAtgtactgctgctgagaGAAAATTACTTGGTATCTCGGCCGATCAATCAAAAT
CTCCACACCCAGTAGATACTTCACTTGCCCAATGGTAGTCAGCTCAAACGACTCCTGCAACTGACCAGCAGCGGTTGCACAGTTATCAGATAGCCCCATA
ATCAGCAGGTCATCAACGTAGACAGTGAGCAATTACACAATCTCACCATCCACTCGCTTGACGTATAGCCCGTAGTCTGAATCCAAGCGCTCGAAACCCA
TTGCAATCAACTTCTCATGTAGAGTGCGATTCCAGATATTAGGTGCTTGCTTCAGTCCGTACAAGGACTTCAGCAACTGACATACATATTCAGCACTCTC
CATTTGAAAGCCTTGCGGCTGCTCCATGAAGATCGTCTCATCAAGGGCTCCGTACAAGAATGCAGTCTTGACGTCATATTGCAACACAGCCCATCCACGC
TGCAGTGCGTAGTAGATCGCAGCACGTATAGTCTCAAAACGAATTACAGGATCGTACGTCTCTGTGTAGTTCACGCCAGCAACTTGCTTAAAGCCGTGAA
TGACCAACCGTGCCTTAAAGCGCTTCACAAAGCCTTTCCCGTCGCGCTTTACTGCAAACACCCACCGACAGGTAATGATCCGGTGCCCTCGGGCTTGATG
ACGCCGAACCAATCTCCATGTCTGATGCGcacgcagcgagcgcagctcTGTCTGCATGGCCTTCTCCCACTCTCGCCAATACGAGCTCGCACGAGCTTGC
TTGTAGGTGTTTGGCACTACTACCATTGAAGCATGCAGCTGCACATGGTTAACCACATAGTCGCGCAGGCGGACA