Description :
From Genome Similarity Track
Location :
scaffold_83:56876- 60614
Transcript NameFunction/comments
g3072.t1 Di-N-acetylchitobiase, putative
g3073.t1hypothetical protein

Sequence
3738 bases(100 bases per row)
GTAGTCGAGCGTGTCCGCGTTCCACATGCCTACACCGCGCAGTCCAAGCTCGCGCACGAGTGCGTACTTAAGTTGGAGGCTGCGCGAGTTGTCGAACCAA
ATCTGCGACCGTCCGCCCTCCGGTGGCGAGTACCACACGAACGGGCTCAGCGTCGTGGGGTCCCATTGCTCGCGGAGACCGTGGCTCTTCACCAGTCGCC
GGACGTCGCCGTAGTCGATCTGTCCACCTGCCGCGTCACTACAGGGGGCACCGAAGAAGGGCACTGGCCGCATCTGGCACCACTCTGCCTGCTGGTCCAC
GCACGGGTAACGGTAGCCGTACCACGGCACGCCCAGCACCAGCTTCTCCGGTGCAATGTCATACCCGAGCAAAAACTCCTGCAGCCCTTGCTTCACCAGT
GCTAAGGGCGAGTTGGCACCCGCAACGCACGCGTCGTACACTTGACTACGCATGTCGTACGACATGACGAACAGAAAGTCTGTGGAGGCGGCGAGCTCGC
GCCACGGGTAGTAGCGACCATCTACGCCTCGAGGCGCCCAAGGAACGTCAAACGTAATCTGCAACAGGGCGAGCGTGACAAATGCAAAGGGGTCAGCAGT
TGAAGTGCAGTTATTCAAGTCGTACTGGACGGACAATAACGTACCTGCGCGTGCTGAGTGAGCGCATGCTGCTCCAGCTCCTGGCGTAGCTCGCGGACGA
GCGAGGCGAGGCATTGCGACGTGGCCCCGTGCATGGGCTTCTCCGTGTCGATGTTCACTCCGTCCGCGTAGTTCTCCACAATCTTCGAGTACGTCGCCTG
CAGTGAAAGATAATAATATTGATAAATGGTGAGATCAGATCGCGCACATTGCCGTTCCTACCTCGATCCATTCCTGGCGTGCAGTGGCGTTACACAGTTG
ATCTACGTCGTCAAAATTGTGCTTCACCACAACCTTCACGCCTTTACTGTGTGCATGACATAGCAGTTCCTTGTCCTCGTTCCATGCCACCGTCGTGAGC
TAGGGAACACACAGTTCTCAATACCGTTAGCGCTGCTAAAGCGTAGCAGCACAGCGCATACGTACCTGGTCCCAATCGTAGTGCTTCCAGCGGTCGTCCG
TCGCCACAGAGAAGGCGAAAACCTCCTTCCGGGGCTTCTGACCGGCAAAATCAATGGGCAAACACAGCGACGCCGAGTTGAGCTCGTCACTGTTGCGGCA
CGGACAGTCGTGTAGACGAGCGCGGTCCTCCTGAGTCAGGCGGTCGACGAAGAGTCCCTTCGCGTCGTACACCGGGATGGAGCGAGAGACGCATTCTCTC
GCCACGATGACCAACAGCAGAGCAACAAGCAGTCGCGGGGGAAGGCGCTGCATGGTCTAGCTTCGAATCGAAGTTCGATGGCACTGGCACACTGTACCAC
TCAAAAGATCGTGCCCCTTCAGAAAGTATCTTTCGGTGGTCGACTTTCGCGTCCCCCCCATGCGCACAGTAAGAAGGAGTTAGACTATGGCTCGACCCAG
CAGCGCGCTCCTGATGAGCATGGGAACTGTCAGCATGTGGGGCTTTTCGCCTGCGTACGACGTCTGCACCGGCTTTTCGGAGTGGAGCAAGAGCGAGAAC
AGAGACGTTGCTGCTTCGATCGGATCGGATGCTGGCAGTGAGGAGAAAATGCCTGCAGAGCCGATCAACGTGTTGCTGGCGGGGCCTGGGGACGTGCGTC
ATGTATTGGCGACTATCGCACGTCGTCACCGATGGGAGGAACACCGACCGGTGCACATCTACATCTTCGAAAAGGCTATCGAGACCCTGGCACGAGACTT
GCTGCTGCTCCAAGTTGCGTTCGATTCGGATATGCCGCTCCGTCAACGATGCAACTCATTTTTGGAGATATTTGGCAATGCTCGCGTGCAGGTGCACTGA
CAGGGTACAAAAAGTGCTCGCGACAAGTTCGCCTAACGTTTCTTTATTTTTTATCTTTTATCAAGGAGAGGACAAGCGCCTACATCGAAGAGCAAGGGAA
GCTGCTGGTGGACTTCGTCTACAATGAACGTGGTCCATTGGCAGGTCTCGTTGATTTATCTCACTTGAAGATGCGCACTCACGACGACCTCATCGACTCG
ATTCGAAGCTGGTTTCAAAGTGTCAAGTTTGACGGTACGACTGAGCTTGACGTGACCTGAGGGGTTGTAGCCACTAACTACCTGGGTAATGCGCACACGA
AGTTGACACGCTTCGTGATCATCGTCTTCGCCACTACTACGAAGTCCGTTACGACCACCGTGACAACCTCATTGACTGGGATTACACCGTGAGCACCGCA
AGCCTTTGGCTGTACACCAAAACGATATAAAACTCAATGTGCTCAATGTGCTTCTACCCAACAGATGAAGCTCAAGAAGATAGAAAACGCCAGCGTAATT
CACATCCGTCAGTATCGTGAATGGAGAAACTCCGGGGTGGCGTTTGAGTTCGGAGATCAAACGTACACAGTGCCAAACCGCACGATGGCAGCATACACGG
AGGTAAGAGTGATTGCGTTGGAGAGATCGGACGGTAATGCTTACCAATGTAATTTTAAAATGACAGGCGAAGAAGAAACACCACGGATCTGTGCTGTGCA
GGGGCTTGTGGACGGACATCATATTGAGCCCTTACATTTCGTTCGGTGTGCACTGCGAGACGTCCAACAAATTTGTGGAGCAGCTCTTCGAGATTCACAA
CAAGGGCACGGGTGTGGAACAGAACCGCCATGTACGTACGAAGTACCATTTTACTATGACATGCAGTACTATTTTGTGATACCGTGGTCTGTATACTCTA
ACTGTCATTTCTTGCAACAGAACACAGTCGAAATTGCTGTTTACAACGTGCTTTCGTATCTGTACGAGATCGAGACGGGCAATAAGTACCAGATGGAAAA
GGTGAAGCGCTATTTGTGTGAAACTCGTTGTGTGAATTGCCTAACGTTACGGATCTTCATACTAGGAGCACGACATTTTCAGCGGCATCGGAGATGCAGA
AGGAAGTTGCACTGATAGCGACAATCAGCCAACAACAGACGGACCGCCACTGCGATTTGAAGAGCTGGACGAGGACTCATGCCAGTTGAATGCGATCGAA
ACGTATGCGGCAAATACTTTTCTGGGTTTATCTATGTCATTATTCTAACTGCTCTTGCCTTGGATCAGGGAAACCCACAAGCAAGAAGCAGCTACAGCTA
CCGCTAAACGACGGACTAGAACCATCAAGGAATCTTTGAAAGGAGTGAAGGTACACTTTTGCTGCAGAGATCTTTCGGGCATTGGGATTTATTCACTGAA
AAATGTGCAGATTATCCCATTGACAGGGAAGATGGAGGACATTTTCTCCAAGAAGCGCTACGCCAGGCTGTTCGATCACGTCTTCGTTTCCTCGCAGCAG
TTCCACACACGTCAACCCTCTGAACACGTCGAGAAGCAAGCAACATCACCATTTACAAGCATTTTGAAGAAGGGTGCGACCGTAGACATCGAGTCTTCTG
TGTAAGTACTGCATATACTTCCAAGTATTATGTTGGGCACCAATTTCAAATGGAAAACTCTGACGTGTACTGGGCACAGGTTCATGCTGCCTCTTCAAGA
GGAGCAGCGAGTGCTCTATGTGACCAAACTGCAAGAATGGGCTGGACATCATTCACTAGAACATACGTTTACCTTCGGTGGCAAAAAGGAGCCCTCCAAC
GAGGATATGACCAGGATTAAGAATGCTGTTCTACGGTT