Description :
From Genome Similarity Track
Location :
Scaffold_886:5687- 7209
Sequence
1522 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGT
TCCCAAGTTGGATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGTACGCTCCGTGCTCGTTGTTAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGTTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTAC
CAACCGCGTGTTCGGTCGACTGTTGAACTCGTTGACAGCCTTGAGTCTCGCCACATGCACTACTGGGTAGAAGCGATACCCTCTTCGGTCAGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTTCATGT
ACAACCACGCCCGGCTCCCAATCTCAAAAAGGGATCTCGGTGGGGCTCTTGCAGGATCGTCCATTTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTC
GTTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTAGCTCTTCGCTCCTTTTCTACAGCCTGATAAACTTTG
GCCGTAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCTAGTGCGTCAGACTGCTTGCCAAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGTGTCTCCTTCCTTGTAGTGTCCTGAGAAGTAATAGCAAACACCAGTTTCTCTGC
GATTTCAATCCAATCTTGCTGTAGAGGGCCTTCCGCGTACACCCGTACGGAACCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGC
CGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCATCTCTGCGAGCGCTTGGAACACCTCGCTCATGAAGCGTGGATCGCGGTCATGCCTAATTAATG
ATGGGGCTCCGAACCGTCGGTACACACATTCTTCAAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATCACGAATCCCGTGAA
CGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGT
ACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGA
CCCAATAATAATCGGACTAAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCAT
CGTTGTCGGTACCACAAGCCGC