Description :
From Genome Similarity Track
Location :
Scaffold_184:5687- 6912
Transcript NameFunction/comments
Hyaar_Emoy2812086exportin-like protein

Sequence
1225 bases(100 bases per row)
TCGCTTACTAGTAGTTTGCTTGTGCCTAAACACAGACAAGCGTCCGTCAATCTACACTGTCATGACATTTTCTCTGTAATTCCATCGAAAACTCTGGACA
AATTCACGTACTTCGTCCGAGCTATATCGCCCCCTTTTACATCATGATTAGTATTCTCGTTATTGTCACTATTGTGTTCGTCGTCCACAACAGCTGGTGC
GGCTCAGTCGCCTAAACTAGGACACCACCACCCGTGTCCGAACAAAAGCCCCCTCGAGCACCATTCGCGTCACAATCCTCCTCCCTCACCCCAAAAAGAG
CTCTTCCCTCGGTCATGGACGCCCACCAGCTGTGCGAGCTCGAGACGCTGTGCCGCGTGCTGTACGAGAGCGCCAATGCGTCCGAGCGCGCCCACGCCCA
GCAGGCCGTGCTCGTGCTGCAGAGCTCGGCCGAGTACATTCCCCAGTGTCAGTACGTGCTGGACCACTCGGCGTCGCCCTATGCGCTGCTTGTTGCAAGC
ACGAGCCTCACGAAACTCATTACGTCGCACTGGAACAACTTTACCACCATACAGCGCGTGGATATCCGTACGTGCTACTTTTTGGGTTGATTTTTCGTCT
TTTTTTGGGCTGGATTGTTGATTTTTGCCATAATGGTGTGTGGTGTATACTTACACTCGTGCAACATTCAACAATTTCTTTTGTTGTTGTTTTTGTGCTT
TTTGGGTACGCTCTTTTTTGTGTCTCCCTCTTTTTTGTGTCATGGTAGGCAATTACGTGCTTAGCTATTTAGCTCAGAAAGGTCCGACGCTCGAGAAATT
TGTGACGACGTCACTGATTCAAATGGTTTGTCGACTCACAAAGTACGGCTGGTTTGACGACGAGCAACATCGTGGCATTGTCACGGAAGTGACGAAATTC
TTGCAAGCGACGGTGGATCACTGTGTTATTGGACTCCAGATCTTGAGCGAACTCGTGACGGAAATGAATTTGCCAGTTGCTGGTCGCAACATTACGTTCC
ACCGGAAAATCGCCGTGTCGTTTCGAGAAGAGTCGCTCTTTCGGATCTTTCAAGTGGCCCTCACGTCGATTAAACAGCTCCAGATGCACAACTTTGGCGG
AGCGACACCGCAGCAGGAAGACCGGATGGGGAGTCAGGCACTGGCTTTGCTGATCAAGTGTCTCTCGTTTGACTTTATTGGCACGAACCCGGACGAGTCG
TCGGACGAGACGGGGTCGCTGCAGG