Description :
From Genome Similarity Track
Location :
contig_60:56853- 58261
Transcript NameFunction/comments
g10671.t1hypothetical protein

Sequence
1408 bases(100 bases per row)
CGGATGCGGACGTGTCGCTACCGTCCGATGAGGACGCAGACGACACGGCATTTATTAAGGCGGATGAGTTATCAAAGATGGAGCGGGACGTACAGGAACA
GCTCAGACACAAGAGCGAGAGCATGAAGACGCTGCTGCAGAAATTGCTCGCTGCGGTTGGAAGCTCGTCTGCTGACAAAACGAAACCTATTGAATACGCT
CATATTCTGCACGAGAAGAGAACAGCAGTCGCGGAAACGCTGAGCCTGAAGAACCAGCTTCAGGCGGTACGTTCGCAGTGGCCAGAATTTCGGGTTGAGG
TCGATGGATTGGTGAGACTAACGCGTTGTGATACAGTGCAAAACCGGATAGCGGACCTCGAGCGCGACGTAGAGTACAAAGAGACAGAGCGCCATCGCGC
TTGTCGAGATTATGACCGACTAAGTGCATATGTGAAGCAGCGCGGTGGTGTAAATACGGATGGTGCCGATGAGGCAGATGTGAAAAGCGAGCTGGTAGCA
GACGGCGAAAAAACTCGCCAGAAGGATACCGAGTCTTCTAGCTCCGAAATGGTGAAGCAGGAAGAACTTATCAAGAAGGAGAAAGAGCACGCCGAGGCCG
TTGCGACTTTGAGGGAGAACATGGGGGTCTTAAGTAGCAAACTGTACCAAGAACGCCAGAAGGTTGAGTCCATGCGGCGTGAGGTGGAGAAATTCAAGGC
ATTGGAAGTGGCGGTAAGTGCTCCTACTGATTTGAGGATTCAGTCCTATGGAATTGGAGCTGTGTGGCTTACTATTGGTGGGTGTGGATGTGTTTCTTTT
GAGTAGTGGAAAAACGATGAAGCTGCGCTGATTCAAGACCACGAAGAAAAGTTTAAAAAACTTCAGGATGAGAAGGTGCACGGTGATGAAGAGTATAAAA
AACTTATTCACAAGGCAAAGGTAGCGAGCGGGCTGTAACTACTGTGGCAGAGTTTCTGCTTTTGTCGTCTGAAGCTCACGCGTGCATCTGCTTGGTTGTA
TAATCAGGATCTTGAGCACCACATGACTGAGAAGTGGGAGAAGAAGATCACGAAGATCCAGACGGAAGTGAGCAAAACGAAGTCGCAATGGACGAGTTGA
ACCTGAAGAATGTGTCGCTACGAGAAAAGATCTCCAACGCATCGACCTACAGAGATCAGGTGGGAATCTTTTTAAACCTCTAGGTAGATACTATTTACTG
ACATATCTCCTTTGGCTGCGGACTTAATTAAAGTTTGCGGAAGCAAAATCAGAATGGGAGTCGGCAACGCGAGAGAACAAACATTTGAAGGCGCAAATTG
AGCGTGAACGAAGCCGAGCAGATCGGGCACAGACCTCGGCAGACTATCACGAAACTCAGGCATTGACGAAGAAGGTGAGATGATATCTTTGGCGTGTAAA
TAGGCTGT