Description :
From Genome Similarity Track
Location :
Scaffold_692:5685- 6703
Transcript NameFunction/comments
Phyta_totarag10195hypothetical protein

Sequence
1018 bases(100 bases per row)
TGATGAATTCGTGAATctcgttcgtcttgttctccaggaacgcgccggcattgaagtacggcaccttgtcgttggtgctcttgtacaccatctcgttctc
gcacgCGTTGGCGAGTGCCGCCAATTTACCGAGATCTTGACTTTAACGAGTCCACCGATACACTACTGAAGAAAAAATGAAAGCAGACAAGCAGTAAATG
CAGAAAACATGTTGCCTCGACACTTTCGTAACAAATGACGGGAAAACTACGAGCGAGAGCAACTATACTTACTTGGGCGGCCCACAGCCGACTATCTCAG
TATGCAGCAGATaagagagaagaagaaaaaagcaCAACCAAGTTACCAATCAATATTCGTGGATTCCCAACCTAAGTCAGAGACGATCTAGTTTTTTAAA
AATGAAATCGACCACACCGAGAAGTCAAAGGGATCGGACCTGCACTCGAGCGCATCCTAGACCAAACAGAGCCCGTACAGTCTGTAGTACGAACTAATAA
CGCATTGGATCCGTATGCTGCCGACTCCGAGCTATCTTGGTCGTTTGTTGTGGTGTTGCTTTCGCTCGAGGATTGTGTATAAACACACTGACGATtaagc
ccccccccccacaaTAAAAAACGCTGACGAAACGAGGAGGCTGCTGTCACAAAGACGACTATGAAGACTTCGTACGATTTTTGTTTGAGATACATTACAT
TACAGTTTAGTTTAACTAACGATGACTTCGTACGATGGAAAGTATCTTCAGCGATTCCGATCAACCAACGATATTATATTGAAGCAGCCTTAGTGCTAAC
AGATCCTCACACACAGGCGGATAGCCACATAAAACTAGCTCGCGAGACAGCTCTTCTGGTGTTCAATACAAACCACCATAATTCAGCGTGTTTTCGTTTT
GATTGCGAGTCTGAGACCACTTGCGCTCGGTGGAGATTTGTCAAAACATGGCGTTTACGACTGCCGATCGACGTCTCTAGATGGTATTATTATTAAGAAG
GCATCGGTTTTGGAGGAG