Description :
From Genome Similarity Track
Location :
Scaffold_25:56840- 58777
Transcript NameFunction/comments
Albla_Nc14028820phosphatidylinositide phosphatase SAC1 putative

Sequence
1937 bases(100 bases per row)
TACGGAATGTACAAACTATTGAGCGGGATGTATCTTGCTTACATCAGAGACGCTCGTGTGATCGGCTCTGGACCACGAAGTGAGAAGATTTATTGTATTC
TGAGTATAAAGTTGATTCCAATCTCTCAGATTTCGTACCAAAACTTTTTGAAAAATGCTTCCTCACGTGATATTCGAGACGAAGAGATTTATGTCTCTAT
GATCGAGTCGGTTTTCTTGGCGCGCACATTTTACTTTTCTTATGAGTATGACCTCACGCTTTCTGCACAACGCAAAGCAATTAAACAATCCATGAGTTCT
GTACGAAATACGGCGATACAAGTGCCAACGCATATTCCCAGTGCTTCTGTAATATCGCCAGTGTCAAGCTCTTCCGGCCCAGGCTCTCAATCAAATGGGA
GCAAATCATCGACATCCTCAACCTCATCCGGGGTGACCATGAATCAGTGCTTATGGCAGCACTTGGAGGATGACTTCTTCTGGAATCGACGGCTCATACA
GCCATTTCTCGTTAAAGAGCTTCATTCGTGGATCATTCCAGTTATCAATGGCTTTGTCAAAGTGATAAAAAAATGTGAAGGATTACGATGCGATTTGTTT
TTATTCACAAGAAGAAGTTGGCGTCGTACTGGAACACGGTTTAATGTTCGAGGAGTGGATAAGGAAGGGAATGTAGCGAACTTTGTGGAGACAGAAATGA
TGATTGTGAAACCAAATGATTCCATCTGCTCGTACGTGCAGATACGAGGCTCTATTCCTTTGTACTGGGACCAATTAGTGACACTCAAATACATGCCTCG
TACTCGGTATGCATACAGCACTGGAAGTGATCGTATCGTTGACTGGAATGGCCTTGCATTTCGAGCTCATATGGATAACATTATTCAGCGATATGGACAC
ATTACAGTTGTGAATCTGGTCGATCGTGCTGGAAGTAGTCGAGCTGTAAGAGATCAAGCCCAACTTGGCACTACTTTTGGTAAATATGTCAAAAAGTATA
ATCAACAATCGTCATCAGCGGATAATGGATCAGAAAATGGAATGCCCAGTTCTTCGCCTCGCACAGGAATCACTCCAAAGGCAAATATGAATAGCAACAA
TGGCGCTGTACCGCATTCTGTCCGAACCTTTACTGACCCGATTCGGTACGTATGGTTTGATTTCCATCATGAATGTCGCAAGATGCAATGGCAGAATCTG
TCAAAACTTGTGAATGAAGTGAAGGATCAGTTTGAGCAATACAGCTGGTTCGAGTGGGATAAAAGCGGTCGTATTCTACAGCGGCAAAAAGGTGTGTTTC
GGATCAATTGCATGGACAATTTGGATCGGACCAATGTCGTTATGAGTCTATTTGCTCGCAGAACGACTCTGATGGCCCTCAATCTCCTCGATTCCACCAA
AGAGAATGTATTAGAGTCTCCATACCGCTCGTTTGAAGTCGTCTTTAAGAATGCTTGGGCAGATAATGCGGATTACATCAGCAAAATGTACGCTGGAACA
GGTGCGCTAAAGACTGATTTCACTCGAACAGGTAAGCGGACTGTGATGGGAGCTCTACAGGACGGAATGAATTCGATCACGCGATATTATCTCAACAACT
TTGATGACGGTATCCGTCAGGATTCATACGATCTCATTGTGGCCAATTATGTCCCCGATAAACGAGAAGAATCGCCATTCACATTCCAGCAACGACACAG
TTTACTCGTATTATTATGCGAACTCGGTGTGGTCCCCTTAATGGCTATTGTCATCTCGGTTTCGGCGCAGTCTGACCTACCAATTCGTACTCATTTATAC
CACAGCTTTGTCATGACGCTATGTACCTGTGTCACTGTCGGGTATTCAATGCTGAAGAAAGGTATGTTTCGATCTTTAGGAAGGCGATATGTCTGCAAAC
CAGCCTTCTGCTCCAGTGGTTACATCAAACGCAAAGA