Description :
From Genome Similarity Track
Location :
contig_60:56834- 58242
Transcript NameFunction/comments
g11139.t1XP_002906863.1 conserved hypothetical protein [Phytophthora infestans T30-4

Sequence
1408 bases(100 bases per row)
GACGCAGACGAGGAGGAGCCGGATGCGGACGTGTCGCTACCGTCCGATGAGGACGCAGACGACACGGCATTTATTAAGGCGGATGAGTTATCAAAGATGG
AGCGGGACGTACAGGAACAGCTCAGACACAAGAGCGAGAGCATGAAGACGCTGCTGCAGAAATTGCTCGCTGCGGTTGGAAGCTCGTCTGCTGACAAAAC
GAAACCTATTGAATACGCTCATATTCTGCACGAGAAGAGAACAGCAGTCGCGGAAACGCTGAGCCTGAAGAACCAGCTTCAGGCGGTACGTTCGCAGTGG
CCAGAATTTCGGGTTGAGGTCGATGGATTGGTGAGACTAACGCGTTGTGATACAGTGCAAAACCGGATAGCGGACCTCGAGCGCGACGTAGAGTACAAAG
AGACAGAGCGCCATCGCGCTTGTCGAGATTATGACCGACTAAGTGCATATGTGAAGCAGCGCGGTGGTGTAAATACGGATGGTGCCGATGAGGCAGATGT
GAAAAGCGAGCTGGTAGCAGACGGCGAAAAAACTCGCCAGAAGGATACCGAGTCTTCTAGCTCCGAAATGGTGAAGCAGGAAGAACTTATCAAGAAGGAG
AAAGAGCACGCCGAGGCCGTTGCGACTTTGAGGGAGAACATGGGGGTCTTAAGTAGCAAACTGTACCAAGAACGCCAGAAGGTTGAGTCCATGCGGCGTG
AGGTGGAGAAATTCAAGGCATTGGAAGTGGCGGTAAGTGCTCCTACTGATTTGAGGATTCAGTCCTATGGAATTGGAGCTGTGTGGCTTACTATTGGTGG
GTGTGGATGTGTTTCTTTTGAGTAGTGGAAAAACGATGAAGCTGCGCTGATTCAAGACCACGAAGAAAAGTTTAAAAAACTTCAGGATGAGAAGGTGCAC
GGTGATGAAGAGTATAAAAAACTTATTCACAAGGCAAAGGTAGCGAGCGGGCTGTAACTACTGTGGCAGAGTTTCTGCTTTTGTCGTCTGAAGCTCACGC
GTGCATCTGCTTGGTTGTATAATCAGGATCTTGAGCACCACATGACTGAGAAGTGGGAGAAGAAGATCACGAAGATCCAGACGGAAGTGAGCAAAACGAA
GTCGCAATGGACGAGTTGAACCTGAAGAATGTGTCGCTACGAGAAAAGATCTCCAACGCATCGACCTACAGAGATCAGGTGGGAATCTTTTTAAACCTCT
AGGTAGATACTATTTACTGACATATCTCCTTTGGCTGCGGACTTAATTAAAGTTTGCGGAAGCAAAATCAGAATGGGAGTCGGCAACGCGAGAGAACAAA
CATTTGAAGGCGCAAATTGAGCGTGAACGAAGCCGAGCAGATCGGGCACAGACCTCGGCAGACTATCACGAAACTCAGGCATTGACGAAGAAGGTGAGAT
GATATCTT