Description :
From Genome Similarity Track
Location :
Scaffold_132:5683- 8119
Sequence
2436 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCGTAATTATTGAATCTCGTACTTAATAGACACTGTAAAATTTACATTTCCGCTTTTGAGATT
TTTAGCGTAATATAACTTGCAATAACTTACCCAGCAACACAAAACGCCATTGTGTTGTTCTAAAAGATAAATCGTCATGTTGTAGTAATGTTGCGGTACC
GACTCCGGCCGCCGACAGCACATCAAAAACACAATGCACCTGTATATTTCACAATATCATGCGAGAGCACAGCTGTTAATCAAATTATCTATCCGAGCGT
CCATTATCGACTCAATTATTGGCAATTTGCTTTTATCAGCAATTTGATTTTTTCCTCCCAAAGAAATATCCCAGAGTCCCAGATTGGTTCGCGCCTTCTC
CCCCCCGTTTTTCACATGTCCCCAAGGAATAGTTTATTCTTATAAAAAACAATATACCTTTTTGCTTTCGCCTGTGCTCAAGTGTATTTCGAGGCAACTT
TCTAAGGACGACATAAGAACGAGACTGGAATTAGTCGTTTGACCGGTTGTATGGATGCAGTTACCGCGCGGTACGCGCGAATAGTTTACGCTACATCGCT
AGAGCGCCTGGCATGCCTTATCAGCACATCCTGGGCAATGTCATTGGCAATGAACTGTACGACTCATCAAGAAAAATCATACGTTGTTATTCGCTGACGC
TTTTTCACGAGCGGCAAGCTACACAATTTTCACCTACTTGCAATACCTTTGCACAAACGGCACACAGCATCAAATATTTTTTATGTAGTATCCGATTTTC
TTGCCGCTCTCATTCCAACTTGTAAGTCCAATCATTGATGTGGCCACTGATGGTGCTGCAGTCATGATGAGACACATGAGTGGCTTGGTCACCCTCATCG
AGGCCGAGATGGAGAATAACATGACAAAGATTTGGTGCGGACTCCACCAATTGAACTTGAATATGCAAATGGTATTTGAGCAGGCACCTCAAGAAACATT
TCTTTCGAGATTGTATGCTGTCATTGGCTATCTCCAACGGCAGACTCTTATTACCAAAATACGTACGACATGTTTAAAAGTCTCGGACATACGCTGGATA
TCGATGTACAATGTTTCGGATTGGATTTGTGTGCACGGATTTGCCATTCGTGGATACCTGGTAGATAAGAAAACCACGTGCAGCCCCAGTTTGGTGTGGT
AGCATTTTTTGGGTTGTATTGAGGGAGGTAGCTAAGGAAGCAAATGCGGATTTCGTGTCTTTTCAAGGATTATCTACACTGGTACAGCAGCAGCAAGCTC
GTTTTAAGGGGTGGCTGAGCAAGCTGTGTACTTTCTTCGGTGTGAAAGGTCCTTTGGTAGAGAAGAGGTTTGCGATTAGAAGTGAAATTGCTTTAAAAAG
GAAGCAATACTATGAACACGAAGGGGACTTCACAATTTCACACAGCGCGGCTGAGGAGCTGGGTTTGTGGGTGTGCGATGAGATCTCAAATTGATGATGA
CGTAAACAACACACTAGTTTCTGCAGTTGCGAGACGGTGTGTGGCTGCGTTCAGCAACATCTACGTTCTAACAAAAGTACCTTGCCTATCATATCCAGTC
ACACCAAAGGGGTTGGCATGCCTGAGCTTGCTGCAGTCATTAACACCCATAAAGCGCGCCTTTTATAGTATTTTGGTGAGGAAGGTATCTATTCAATAGG
GCATGCGTTCGAGCAGCTCAAAGGCTTTTACAGTGA