Description :
From Genome Similarity Track
Location :
Scaffold_257:5683- 6808
Transcript NameFunction/comments
Phypl_g6055hypothetical protein

Sequence
1125 bases(100 bases per row)
CCTCTGCAAGACTCGCTGGCAAACACCATTCGCGATCGTACCGCTCGTAGCCTTCTTCATCAGACGCAATTTCGAGTTCGTCAAGCGGTAAATCAAGATT
CAGTTCCCCTTCCACCACCGTGTCAGTCAAATCACGCCATGCCGGCTTATCGGGTTGGCGGACAAGGGCCCGGTAATTTTCGATACCCCGTTGTACAGCC
ACCACAGTGAGCGCTTCCACAGCATTTTGAGACTGGATATCAAGCCACATAACTTGTAGAATAGCGCCGTTCTTTGGTTTCTTGACACGACGACATACCC
GACCGACAATATAGGCGGTGCCCACACACCTATAAATCTTGTTTTTTTGCATCCACGGTTCTTTTGACGGCGAAAACgccaccatcttcttctgcaagaG
GTGCTCAATACTTGGTGTGGGTGGAGTGCGATTGCGAGGCGTAGTACTTGTTGCGGCGCTAGTCGATGCTGTCGGAGTCGCGTTGTTTTGATCTGCAGGA
CCTGCGCTTTGTCGTCTTGGCTTCTTTGCCACGCTACctccacgagcaccagccgTAACGCGTTGCCGTCCGCCAGAACCttcgccaccaccaccacctc
gacCAGACCCAGCATCACGAACACCCTGGCCAGGTCCAGCAAGATGCCATCCACCCGCACCGCCACCATCACGTCCACGACCGGCACCACCCACAACGCC
ACCATTTTCTGCGTCGTCACCGACACCATGAACTGCTATGGTAGCGGCGCAAACACCCCGACCAGGTACAGCAAGATGCCGTCTAcctgcaccgccacca
ccacgtccatgACCGGCACCAACCACAACGCCACCATCTACTGCGTCGTCACCGACACCACAAGCTGCCATGGTAGCGGCGCGAACACTCTGACCAGGTC
TAGCAAGCTGCCGTCCACAAGAGTCGCTATCACCACGCCCACGACcgtcgccaccatcgccgcgctgctgcccgcgAGCTGTGGTATGCCCACGACCACT
GGTAGTTCCATTAAAGCAGCCAGTGTGTGTGTCCACACCGACATGTAGTGCCGCCACAACGGCAACATGAGCGGCAACAAGCTGCCGTCNTGCATCAAGA
GCGGTGCTGTGCTTCAGGCCGGCCG