Description :
From Genome Similarity Track
Location :
scaffold_243:5682- 8253
Transcript NameFunction/comments
Pl_107135hypothetical protein PHYSODRAFT_560624
Pl_107136hypothetical protein PHYSODRAFT_506421

Sequence
2571 bases(100 bases per row)
TGCAATAACAGCATTTGCTCCGTAGATCGCGTCTGTTGCTCCACCATTTCCTGGAGTAACGCCTTGAGTTCGGCAATACTTGTAGGGTCCGTGTTGTTCA
ATACAGCAGATATCGTCGCTGGATTCGCTATCGATGACGGAGCACTTGTTGTTGACAAACTCGTTGGTTTTTGGGTCCTCGATGCCGCGGGCTCAGGCGT
AGGGGCGATGAAGCTTTGGGTCGCAGTGGAAGTGCCTTCAGCGGGAACAGGCGACGCCGGCTCACTGTTAGGTGTGCTACCGGCAGAATCTTCATCATGA
CTCGTAGATGTGCGAGTAACCTCTCGTGTTGGCACTGCGTTGACCGCTCCAGTGGCGATCGCCACGTTCTGCGCAAGCAGGGCAGCACTAACAGGGTCTC
CGCCATCCAGCAGTGTCACCAGCTCTGTCATGAGCACTTCAAGTTCACCTGCAGGAGCACCCTTCGACCCCACAACGCGTCCATTGTTGCGCTTGACGCG
TTCACGGTACTTGGACACCAGGTTTTCAAAGCGGTAACGCACGATAGGGCCTTTGATATTGTCCTTGGAGAATTCCGGGCTGTTGTCCAGCTTGCTTGCC
ACATCTTCCCACGCCGCAGAGATAGCACCAAACTTAGCGCGGAATGGCAATGTCTCCTTCACGTACTTGACAAGCAATAGGTCGTCCCCAGGAGTAAACC
GTTGGCGGGTAGCCTTAGTGACAATGGGCAGCGCCTGGTCATCAGAATCCACGAGAAGAGAGGTAGACGACGAGGGCTGTGGTCCCAATGGGGACGGAGC
AATAGTTACTTGGGCGGACACCAGCGACGGTTTCTTCTCCACCGGCGCTGTGCCTTCCTCTGCCCGGATCTTCCGAGGTCGACCGCGCTTGCCGAGTGTC
TGGGTCTGGGGTTCCGCCTCTGCAGCATCCAACTTGGGAAGCAGCTCAGTCATGACGCTCTGAAAGGTGGAGTCCTCTGATGGCGCATCATCCGGATGGC
TGCCGTTTTTGACCCAGTTGCGGTGACGCGCTACGAGGCGCTCGAAGCGGTTCTTGGCGATGGGTCCCTTGAGGTGGTGCATCTTGAAGGCGCTGCAGCC
GTTGAGGGTATTGGCAACCTTCCCCCACCCAGCCATGAGTCCACCATACGGCGCGCGAAATGGCAGATCCGTGTTTACTTGCACGACCAGCAGGTAGTCT
TGGTTTGGACCAAAGCGCTGACGAATACGTTGCTTCGGCGGCATCCTGCAGGCAGACAAAGCTTTCTTCCCTTCGCGGTTTTTTCGTTTTTCAGGTTCGA
AGCGCCAGAAACTAGGGTCATCTGGAGCCTCCGTATTCGAATGTAGTCAATGTATGTGAAATGACAGGACCTCTGATCATCACAGTCTTTATTGTATACT
TTATCTACCCTCAGTATAATTCAAAGAGCAACGAGAACACTGGTTAGATGGTATCGATAAATACAGGTTCAACTGATCGTGTATTTTGCAAGAACGACCG
AAGCGTAGGCCAGCTTGGAAGACTGCTGACAGCGATGCACTCTAAGCGAAGATCACATTTTAGTAAGGCCATACAGCGGGATGTTCTGCAGCGACTCCTG
TGGAATGACATTCACACCAGACTGTGGTCAGTTATTGTCGGTGGCATCACTACTCAACTCAGCGCTAGTTAGCTCACAGGCCGCAACGCACCGTCGATTG
TAGTGAGTTGATCACGCAGCCGCATTCCACTACTTCTCCGCCGAGCTTCTCCACGAGCTCGACTGTCACCTTGAGAGTTTTTCCCTACTCCACAGCAAAG
TGAGTTCTGCTGCGACTACCGAAACAAACACAAAATAATCTGGCAAGAAACTACCGCACCGAAGCAACCAGGTCGTCGATAATGACAACGCGTCCTCCGT
TCGTGATGGCGTCCTGGTGAATCTCCATGCGGCCGCTGTAGTAGCCCGACACATAATCCACACCCACAACGTCTCCCGGTAGTCTCCGTGCGCGGCGCAC
TGGCACGAAAGCAGCTTGAAGAGCCAATGCCAACGGTGCCCCAAAGATGAAGCCTCTGGACTCGGTGCTAACCACGTGTGTGATCCGCTGGTCAGCGTAT
CTGAGCGCGAGCGCGTCGATTGCAACCCGGAAGGCTGCAGGATCCAAAAGCAGCGTAGTGACGTCACTGAAGTCTGCTCCCGGCTTAGGAAAGTTACTGA
ACACGCGGATCTTCCGTTTAATATACGCGGAGACCTCTTCCTCGTTCGACAGATCCACAGGCTCCTGCATTGCGAGCTTCTCGCTGCTCATGCTTATCGC
GCTGAATGCGCGTGGACTATAAAATATATCGGCCTAAATATTTAGTCCGATACATTTTGTAGTCGGATTAAAAAGACCAATTGTGCAGTTTCCTCATGTT
CGCAGCAGGGCGGAAGGCGGTGGCGCAGGACGTCGACACAAATACTGAAGGCAATGACAGTGGTATGTAGGTCGATTAAGCGTGGAGAGACACATATGAT
GGTGTAGTAACGCTGTGTGTGGTTGTGCTTAGACTGGCTGAGTGTAGGCAAGAGCTTTTCCGGTGGCAAAA