Description :
From Genome Similarity Track
Location :
Scaffold_21:5682- 31299
Transcript NameFunction/comments
Phypl_g897hypothetical protein
Phypl_g898regulator of chromosome condensation (RCC1)-like protein
Phypl_g899hypothetical protein PHYSODRAFT_307660
Phypl_g900conserved hypothetical protein
Phypl_g901hypothetical protein
Phypl_g902hypothetical protein

Sequence
25617 bases(100 bases per row)
ATCTCAACTCACATTGAGCACCGCAGTAAGGTGCAGACTACCTTTTGTGGATCGAGGGACCCACAGCAATAAGGAGCCTCCTCCCGTTCCAGGGAGACCC
AGGAAACCCGGACGCCATCGATCCAGGTACAACGTTTTCCCCGCAAGATCCGTCACATTTGCCTTCCAAGTCATGGTTTTGCCTGCTGGAACAGGTACCT
CGGCAACCTTATCGCCACCAGACTTGATGTTGACAGTCACATCTTCAGTGTCGACACTCTTGAACGTAATGGCGACAGTGCCGTCACCAATTTTTGTCCa
catgccgctgctgttgttgaaAGCTCCCTGCACAGTCTTCATACCCAGCGCTTTCTTCACATCACCGTCGTCAATCTCTCCGATGAGCTGCGTGGGGCCG
CAAATGGTTTGAACAAACTCAGAAATTACGGAAGATACGTAAAACGGATCCCAAATGGACCAGAAAGCGATCGATCTATCTGCAATCTTGAAAGCGTACT
CCCCAAAACTAAGCAAGGTGCCGTTGTTGCTCGTTCCCGCACTGATCAAGTCGTCCACAATAGCCCCAAAGGTCTTCCGAAGAGTATCGCGCGTGACGTA
TGCAGTGAACTCATCTGAttcctccagcaactcgttcaTGCAGTTATTCGTTGCCATTGGGATGTCGTTCGTCATGAGGTATGACTGGCTCATGATAACT
CGAATGTCGTCCTCCGAGATTTCAGGATTTAGTCGACGCAGTTCTGCCACCGTCATCCACGTACGATCCAGGAGACGCTTCATGTCGTAGCCACACGTTG
TGTTGGACTCCAGTGCAGACTTCAAAGACGTGATGTCTGCCTCGTTCAATGAACTGATGGAGCCACCGAGAGCGATGTTCTTCATGAAATTCGTGAACGA
GCTCCAACTCGAAAGAATGAAGGCTCCGTTGGTTATGATTTCCCTCAAAGCGTACTCCGCAGTCGTGAGAACACTGTCCACGAACTTGACCTCTTCGGAC
GCTTTCTTGCCGATGCAATAGGAAATCGTTACGGGAATGTCGATAATGACATTGTCGATCTGGTACAGGATGGCGAGAATCTTGTCTTGCGAGGTTTCTG
GGTTGTGAACTTTGATGTAGCGAATGTACCGGACCAGAGACTTGGTGAGGCTGATCATATACTTGGTACACTTGATGGCGACTTGAACACTCTTGGCCCA
CTTGGTCATGTCACCGTATACACTCCAAGCGGAGAGCGAGATCGCCGTCTGGACCACAACTGCGACTTTGTAAAAGACTTCAGACCCACAATCATCATTC
TGCCGGATGCACTCGAGGCCACACTCGATCGGATACGAATAAGGACACTGCGTCCAGCACATTCCGAGCTTGCTGTCGAATCCCAGAGGACACGTCTTCG
CGATGCGAGCTTtgcgccagcacgcgcgagaATAGGAATCGTCGAGCGCGGTGCCAACCCAGTTCACGTACGTTTGCTCAATGGTGCTCGTCGCGTTCAG
CACGCTGCCGAGCTTAAACGCAGCGTTCATCACTGCTACCGTCGTTGCAGCCCCGGCGCCATGCGAGTCGCCGTCACTGTCTGTCAAAAcatcgtcgctg
ctgtcttccacgtcgtctccatctcgctcaGATGTGGCTTCATCGCTGCTTCTGGACAAATCGTTGGATGTCGTTGGCTGTGGTGCACTTCCGGTTAGAT
TTCCACCGCTGCCGGCGACGCTATGCTCCTCGTTTGAAGAGTTGAACTGGGGTTTGGGAGTATCTGGAGCACGGGTCAAATGGTCAGCAGGAtgcacagc
agcgagtggCATTGGCGCTGGTCCTCTGTCGAAGGTGTAGATCTTCGCCAACGATGTCTCACTGAGCGTTGCAGTAaacgctgccagcagcagcatcgtc
accgtcgtcaccTTGGTTGAGAGCATCGGGGTCAGTGGCCGAATGAAAAATGAGGTGACTCCGCTACGAGGCTTCGGAGTTGGTTGACGCCTTGCCGGGT
GTGGATACCAGCGAATCTTTCCAGTTTAACCAGCGACGTCTTCGGCAAAGCCGCGGCGAACGGATCGTTGACAGGCGCTGCTTCCAATCGCCAGTATGAT
TTCCATCTCGTTGATCCTTGCTCGTTGATCCTTGCTGTTATTATGTAGGGTGCGCACTGCGCAGTCACTCACTTGGCTTGGCTCAGTTGACTGTCAACTT
GACAATCGGCTGCACCCGACAACGTCGTGACgtggcgacgagcaggatCCAAACAGGGATTGGACGCGGAGGGCGACAGCCTCCGAGCTCCAGTCGTTTA
ACACCGGACTGCAACTGACGAATCCGCATCAAACAAAACGATTGCGTCGAGGCATTGCACTGTACACAATTGGAGCTGTCCAGAAGGCGACACACTGACT
GTAGCCTAAAGTCTGTAGTTTACGGTGCCGCTGATGCGATCgctgaaatggctacatAATATAGTGTGATGTGCAACATATTTATTTGTGTGTGCCGAAA
ACAAAACCTCCCAGTACATCAAATTTATGTAATGTTTGCGTGGTGCGGTGTCGTCGCCACACATATCCGCTGCATAGATAGAGGTCGACATGGTGCACGT
CTTGCTCGGCGCTCTCCGCTTGGCGGGGCGACGCGCCACCGCTGCCAGGTTCTCGGCCAcccgccgcgtgctgcagaccgcctccttctccacgcaGTCC
AGCGGTGCGTCGTCCTGAAGTTCCGCCAACGCCGAGCCAGTCGGTGCCTCCTATTGGCCAATTTCATACTAACGCTACTATCCTCATTGTACTACTACGC
AGTGTACACGTGGGGCAACGGCACGCTGGGCCAGCTGGGCCACGGGCCCGTGGTCAAGTCGGGCATCCGCAACGCgtacgaggagctgtcgcccaagctg
gtggaggccTTCGAGGGCAAAGCCATCACCCGCGTCGAGTTCGGCGCCagccacagcgccgccagtACGTCCAATGCTGCTATGTAGTAATATTTGTGTT
ACTGGTAATACTGACTGACTGTATTACTATTGTGTGTGTGTAGTTGACGAGGAAGGCAAGTTGTACGTGTGGGGCAGCAACGAGTACAGCAAGTTGGGCC
TCGGAgagagcagcgagatggaggagctcccgcgcgaggtggaggcgctcaagggcGTCAAGATGGTGGACGTCTCGTGTGGTGACTACttcacggcggc
ggtggacgaggacggcaaAATGTACTCGTGGGGCTGGGGAGGCTCCACCATGAAGGGCGCCGGCGGTCTTGGCCATGCCGGCGGcaaggacgaggccacg
ccgcggctgctgaagacgctggtggaccaGGGCGTACCCATCGCCACGGCCGAGTGCGGCGAGTTCCACACGGTAGCGCtcaccaaggacggcgagatCT
GGGCCTGGGGCAACGGCGAGTACGGGCGGCTGGGCAACGGCGAGTCCGACACGTGCGAGGTGCCCGAGCCCATCGAGTTCTTCTCCAAGGACAACATCGT
TTCgatcgctgctggtcgcgaCTTCTCGTTTGCGCTGAcggacaaggacgagctgtacAGTTGGGGAGGCAACAGCCGTACGTTGTTGACGGTGCTGTTG
TGTGTGTTGTATGGGGCGTATTTGGAGCTCACGCGTTTGCTTGTTGtgggctgctggtgcagagAACCAGCTTGGTATCGGCGGAGGTCTGGCCATGGAC
GTGTACAACATTGAGTCGATTCCtgtgctggtcgaggcgttCAACGGTCTCTCGGTGAAGCAGATTGCGGCCGGCTACGACCACGCGGCCGCTGTGACGG
AGGACGGGCGTCTGTACATGTGGGGCGCTAAGATCTGGATCGAGCCGCACGAGATGACGGCCGTGAACGAGCACAAGGTGGTGCAGGTGGCTTGCGGTCG
ACAATACACGGTGGCCTTGAccgaggacggcaaggtcTTTACGTTCGGCAAGGGTAGCTCCAACTGCCTGGGCCACGGCGACCGCAAGAACCAGCTGCAG
CCGGTGCAGATCCAGGCTCTGGCTGACGTTAACATCACCTCGTACGTGTCTGGCATTTTGCTGAAGTTTGGCTGATGACGAAGTAGGTGCTAACTCTCGT
GTGTTGACTGCTGTGCTGCAGGGTCTCGTGCGGTGACTACCACATGGGCGCCATCGCGACACCCCacgccgaggccgcggacAAAGACTTTTCCTTCCGG
GAGTAGGGGGTGCCTCGTAATGGCAAGTCGTAGCTCGGACGTAAGCAGAAATGGATCGCTCGCGTTCAACCTGATGCCGCTGTTGCTTCAACGGTTTACC
TGGTCCAGCTCATCTGTCCCTGTAGTGTCCGCACGCCGATGAACCGTCGCGCTCGATCTTGCATCCCATTTTATCGTTGTGTCACTGATGATTCGCttga
tgttgctgttgtgcgTGGCCATTCTCCCGTGGCTGCTACTGCTCTCTGGTTCCCCCGTGTGGCCGCAGTTTGGCAGTGAAGCCAAGTCGAGTTGGCGACC
AAGTGGAGACGGAACTTCGGCTGTGTCAACGCTCAATGGACCAGACGCATTCGAGTGGCGACAACTGCTGCGGTGGTGGAAAGGAAGACGAGAGCTCGCA
CTCACGCTGGACACGTGGCCCGAGCCGGAGATCGACATGGACGAGTGTCTGACTCGCTACCGAGACGCCAAGCACAACGAGGTCTGCGTCATCAGCCGCT
AGACAGGAGAACGACAGCTTTACAGCGTGAGATCACTTGACGTAGTCCATCTAACAGTGAAAAACCTATCGATCTATTCGAGTTTGACGCTTGCTTACTT
GCCGTCGCGCTTCCGTTTGAGGTTGTGGCGACTGTGCATGACAGCGGATCCGGTGCCGTCTGATGATACGACGTCGGTGACAATGTACGGAGCTTGGGCG
GGCTCGTGTGCGGACAAAATTATGTTGTCGAGTggcatgctgctgcgtaCCAGCAGATTCACTCGCTGCAACACCGAGAGGGGCAACGGACTCAGGATGA
ACAGCTGACgcttctcggcgtccacggcaCGAACAATGCCCACGCCGAGACACGGAGCATGAACTGGTTGCAACACGATGCGTGGCGGTCCTTCCGAGTC
GTGATCCTTGATTGGTTTGTAGTCGGGATTGATACAGAGACCCACGACGCAGGCGTTGAGGGAGAACAGGAGCTGGCTTGGAGCCACAGAGGAGCCGGCG
AAAGCAACATCGACGTGGTCGAAGGACACGGCGAAGGGGGCGAGTTGGGCGTACGCGCGGTAGATGTCGCTGTCCACGCGGTTCTTCTCCGACAGGACTT
GGAGGTTCTGCAGTTGTGTCCGCGGGAGGtcgcagcgagcgcgagacAGGAAGTACGAGTGGAAGCGATAGACCCGCAATTCCTTGGAGCTTCGTGGGGT
TTGAGTCACGCCCACGGGGTCCCAAGGCGggacggcgtggacgcgcCACCGGCCTTCAGTGGGGACGTCAAACTGCTTGTTCTTcgtcgcggccagcagc
tgcacgacgtggTCCGGGTTCGTCTCCTGAATGACGTTGCACAGCAAGTCATGCCCCATGCTCTTGATCCACCCGTCCGTGTTGATCACCAGCGGCACGC
AAGCCGCCTGGTGTCCCCACTTGACCTCATACAGACGCAGCAAGCTCTTGACGGCCTTCATGTAGTACAACGGGTCATTGCCTGGGTTGGCGTTGCCACA
GAAGAACGACCGGATCGGGTTCTTCATGTGCGCGAACCCCGGGCCAAGCAGTGGCGTCGTCAGGGCGTGAAGCGCCACCAGCCCAGACGGCGTAAGCTCG
CTCTGCCCCACATCCGTGTCCAGGAAGGCCACCGTGCCGAACTTGGCGAGCAGCCGGTTCACCAGATACCTGCAGAACGTCGACTTCCCTACGCCCTTGC
CCCCGCACACGACGATCTTCTGCGACGCCGGGACCTCATCCGCCAGCAGACTCGCCTGCAGTCTGTCCACCGTCGTCTGCCAGGGCTCCGTGAAAttcag
cgtcttgaaggAATCCACCACCACTagctccgccagcacccGCTCCGGCGTCTTCCAGTCATGGCGCAATGGGTCTGTGTTCAAAGGCGCAGCACTCGTG
CAGTCGAAGGCCGCAGTGAGCGCGCTCAGCACGTTCTGGTTGTGCTTCGAGACTACCATTTTGAAACCTGGCAGCACCGCCGACGGCTTCTCCGGTCGTG
CGTTCTCGTAGAAACTCGTGACGTTCCCGTAGGTCACGGGGatggcgcgcagcaccagcacaacGGGGAAgtcgtccgcgagctgcacggccAGTTTGTC
cgccgcgatctcctcgtcctcgttcaCCGCCTCCGCCGGCAGATTCGGCTCCGTCGTTTGCAGCAGACTGGCGTTCGTAGGCCCGAACGGCGCCTGCGTC
TCTTCATTGCCCGGTCGGCCCTCGATCACCAGCAAGTTGCTCCACTTGGGTGAGTGCAGCGAGAAGTACGCGCCCAGCGGCGGTCGGAACCCCAGCAACT
CCACGTGCCCCTGGAAGACCCGGAAGAGCGTCATGCCGGCGCAATTGACGGACGCAGAGCTCTGCATCCCCAGCGCAACCACATTGCCCGAACGCACACA
CAGCGCTCGGTacagcggcgaggacgccgccgcccccgccgcggGGCCGTACTGCGAGATGTCCGCCATCGCTTATGATAAACTTTTGGCCACCCGTAAT
TTGAGGCGCTCTCACACGTCGCATGTTCTTAAATGAGGGTTTGAGGCAGTCAACTTCAACCTACACGTTCATGTACACCTCCTCAGCAGAGACCATTGTA
GAACATCTTGCGCCTATTCTCGGCTTGGAGCTAACTAGGACGCGGAGTTATTTTCGAGGCGGGGGATAACAGTCGGCCTCGTAGTGCCAGCCTCCACTTT
TGCTGCTCTCTCTCTACTTGTAGCGCTGCACTGGAGCCTAAAGCGCCATCGACCAGAGGCCAGCACTGCTGTCGACTCGAACACGGTGGCGGGAGCATGT
TACCGGCGCTCAcgtccaagcccaagcagGCGGTGCGCCAGGTCAAAGGCTTGACGAATGACTCCATCGACTCGTACTCGAACACGCCGCtaggcggcgg
cgcgggcaTTGGCGGCGCGGTGGCGCCCACATACGTGGATAACACCGAGTCGGGCAGCGCAACGGCGCGCGGgtcgccaccagcgacgagcagagCGACT
GGCATCAACACGGGGCGTTCTGCTACCGTTGCAAAGTCGGAGGAAGGAGAGACGCTGGCCCGTGTGGTGCGAGACCGTAAGGCTTCCGGGGAAGAagagc
tgtcgctgcggaCGGGGGATGTCGTCAAGGTGCTGTCCACGAAGCGCACCGGGTACCTCAAGTGCGAGGCCGCAGACGAGGTCGGCTACGTGCCGTCCTC
GTACTTGGAgttccacgacgacgccgagaacGGCACTAGCAACGCTGCAAGTGAAGACGCTCAGCGAGCAGCGGAGAAACAACGGAAGaggcagcagaag
aaggacaagcggaagaaggacaagcgcGAGGCCAACGAGGCGACGGAACCCGAGGAAGCGGCTCCGGTCACCGCCCGCTCGCCCCGCAaaggagctgaag
acgaaggcgtcgagtCCCCacgcaagcgcaagaagaaagacCGCAAGCATCGCGATCGTGaagcggacgacgacacacccagagctggagctctggAGGA
GTCCGCAAGCGCCAGGTCTCGAGCGGCGCCTGAGGACACCGAACGATCTCGTAGTAAAAGCAAGcactcgaagaagaagcgccatCGCGGTGCAGATAGC
AGTGACTCGAGTGAAAGCGACGCGGGGAAGCGAAGTGGTCGCTAcggccgccgtcgtcgcaaTCGACGGGGATCAAGCGATAGTGATTCCGATTCAACGT
GCTCCGACGACTCGGAAGGGAGCTACAAGCGGagacgacgtcgccgtcgccacaGACACCGCCGAAgttccagcgacgacgcagaagaagacgataGCGA
CTACAAACGGCGCCCCAGGCGTAGCAAGAAACGCCGCGATAAAGGCGACGGGGACTCGGAACCCGACGAAGGATCTCGCTCAGCTCGaaaggccgagaag
aagaagatggctGCAGTGTTACAAGAAGTGGAGAAAGGAGTGAGCAAGCTGGACGTCAAGTCCGAGGAAAAAGTATCGGAGGCAAAGACCACCATCGCTT
CATCGAGTAAGAAGGAGGAACCTGACCACGACCGAGGGAAGAAAGAGGAGACCGAACGTAGTGAAGGTTCGTCGGAAGGACGGGCGACGAGCGTGTCGTC
GAGCCGGAAAGATGACGAAGGTCGTGCTAGttccagcgcgtcctcctccaaCAAGCAGAACGGTAGCAAGTCGGGCCTTGGCAGGCAAATCGGCGAGAAG
ATGCGCTCATTCTTGGGTGGGGGCAGCAAGAAACAGCACAGTAGCAAGAGTTCGAGCGGCATCCTGAACGCGTGTCCAGGCACCGTGCAGGGCGAGGAAG
GTTGGTACGAGCACGGCGAGAACGAACGCTACTACTTTGTGCTTGTAGAAGGTAAATGGAGTCTTCTGTACGGACCCATGACTGAGGAAGACTTCGAAGT
ATTTTCCAACCGGGTAcgtgtcctcgtcgttcttgcGAACTTACCCACCATGTTGGTTTTAACATCCATTTTCCCTCctgcaggtggtggagcaaAGTcg
cgccatcgagctgccACCGACATATCTGCACAAGTCGGGCTACTTTCTCAaccgcgagctgcgtgtgCAGAAGGAACAGTGAAAAGCGCAAGCAAACTAT
CACTATCAGCGCTACCAACTTCTACCAAATATATCATGAAAACGAAAGTACCAGTAAACAATATGTATTATTCATTCAGAAAAGTGGCAAGCACTCAAGG
ACAGACTCGCATCTCGTTGTTCTCTTACTTTGTCGGGCCGGCCAAAGACTCGCTGGCAGCTTCCAGGACAAGTTCCTTCGGGAAATAAAGTTCGGGTCGG
ATGGAGTCCTCTTGGGGGCCAGAGCCTGTCAGCCACTGTGTGGGagaccgcagcagctccttgagctcttcaCTCAGTGATAGTTTCCGACGTGGAGACG
TCAGTTTGGGCTCGATCGCTACCTTGAATTTCTCTGCCTTGGCCTTGCTCGGTGACGTCGCAGAAAATGCCGCGTTCGCTGCAACTGCGTTCTTGACGAC
CTTCCAGCTTGTCTGTTTCTCATGAGGCGATAGAGGTTGCACCACTCGCTTTGAATGGGACAACTCCTTCCACGCTGAATCATCCGCGGATTGACTGGTA
ACATCGCCTTCCGTAGTCAGATCCAAGTGCAGGCTGGACGGCTCCTTGCGCTGTCCAAGCCGCACTTCATTCAGCTTGCGATCCACAAAGGTTGCTTGCA
ACTCGGGAGCCACCCGCTGAGCTGAGGCGGCTACTTTGTCTTCACTCAACTCCTCCGAGCCTGCCTTGCCTTCCGTATGATACTGCATTTTTCCTAGCAG
TTCTGGCGTACGGGTGATGCTGAAAGTGCCCTCCCGGTGCatcttgacgagctccgcGAGATGCTGTTGATGAGGCAGCCAGTGCGTTGCAACCGTGTGA
TAAGCTTCACGGTGACGATCGTTTAATCCCTTGGGCACGACACACACCTGCTCAAGCTTGTGCAGTAGTACTGGGGTCTCCTCCGAGTGCAACTTCCGGT
TGTTCATGCAGCGCTCCGCATGGGTCACGAGTTTCTCGAGCAACTCAAGGTTCGCCTGATACCGTTCCTCGAGTTTTGCTTGTGCCTCCTGTTCACGATC
TCGTAATCTGGAACACTTGTCACGAACCTCCCTTAGCAGTTTTTCGGTCTTCACCATGTCCATTTTGTTGCCAGCTTCAAACAGGAGCAGGCGATCAAGC
AGTACCTTCACTCCCACCCCTTCCCCAAACTCGTGGTCACACCATCCAAGTccgcgctgcagccaccgGTTACGTAACGTGAAAGCTGCGGATGCCCACT
CCATCCTTTGGCGGTGCGCAGCACTTAGCTTCCGCTTAATGCTCAATGCCGACGCATCAAATCCTAGCAGCCAGTCGGCAATGGACTGGCTGAGTGTCCA
ACGTGCTCGCTGCTTTGGAATAGGCAAACCATCCAGGCTGCTGAACTCGTCATACGGGAATGTGTCTTGCAATCGATTCTTCGCAAGATCCACTCGCGAC
CGAAAGCTCGTCACCTCCTGGAACACGTTAGCAGCGTAGCTGATGGCGGCGTAGTGCGACATGGCACTTGCATTTTTACCCGCCGGACAACGTGATAACA
TTTCGTTGCTTGGGGTACGAATGCGCCCCGTGGCAACGgcccgctgcagctcttctcTCGTAAATGCCTCGGGTGGGAGTCGGTAGTTCGCACCAACAAT
GCGCTTATTGACGTTGTGCAATTCCATGGCTATGTCTTCTTTCGTCACAACTTCATCTCGAGACTTGCCCAGAAGAGCTCTCACGCAGCGGTCGAGTGCC
GCGTACTCTGCTAACCGTCTAGTGTATGATTCATGCACTAGTAgtcgctggaagcgcgcAACAAGCGTCAGGTAGTCGCCGCTAACATCAACTTCGGCAT
TTtcaacggcagcagcgaacATGTCAGCTTCAGTCCTCTCCGTTTCATCGTCAAGTACGTGTGATTCACCGGCGAACGTGCGCACCAACGAGTTTCGCTT
GCGGAGTGCTTCAAACAGCAACGTCTTACGAAGCGCCTCGATTTGGGTGTCGATAATGCCCAGACCTGTGTTCAGTGCCTTAGCAACATTGCCAGTCTGG
TTGTTGGCGGGCGCTGTGGATTGGGTACCAATGCGGACCCCACGAAGCATCACGGGCTCGCCTTTGCGGTCCATTCCTCGATCCTCAAGTAGTGTCTGGA
TACTGCTTGTATCCTGCGGTAGAGCGACTTCCTTGACTTGATAACGGTGCATTAGCTGAAGCAAAGTCGTGGGGTTCGCCGTGGTCGGAACCGCGACCCC
CTTCGTTACTagcacctccttctgcaACGTGAATGCGAGCGATTTCACCAGATTTTCAACTTCGATTGTTGGGATCTGCCGTAGTATCATCTCTCGCAGT
AGCTTCTGGTAGTTTTCCGGCACTGCCAACTCCCGATTTTTGCTCACAGCATGACTGACGTTCCAGAGCAAATCAGTCTTTCCAAGGCTCTCCATCGCTT
GGTAGAGCTCAGCTACGCGTTCTGGGTTCGGCAAAGAGAACGCTTGCTGGTTGTTATCACGATGTCTTTCGAGGACCTTTTCAAGTCGTTTGATTTCTTC
GTCGATGTGCTTCGGCAGTACAACCGTCTGTGAGCCAGACTTCGAATCGAGCAATGACGGCTTGACCCAAGCATCGTCGTTTGCTCTTGAATTATCAGCG
GTTGGATCAAATGTTGACGTTTTTGGAATCACGCCACGATCTTCCAGTGCGAGACGAACGTTAGCAGGCGTGAAGATCATTTCTTCTTGCGTAATTATCA
GACGTGTATCCTTTCCATCACGAGAGTAAGGCAAccagttcttcttctctgCGTCCATCGTGATGCGGTGGTAAGGAATTCGCTCCAGTTCGTACTTCGC
TTCCTCAATGGCATACCATTCTGCCATGCCCTCCAATTGTCCACTGTCTTCAGCGACACCATCGGACCTAAAGCTCCCTTCAGACGACATGCGGCTACCA
GAGTATTGTCGGGACATCCCACGTTTCCTACCGATAGCATCATCTTTAGTTTTCGGGGAAGGCGGCGGTACCCCCCTAAGACTAAATGATTTCTCTGGCT
TGTTCAAGTCTTCTTGCCGTTTTGCACGCGTAGGATTCCACAAGTGCATCTTTTCCAGGATAAACGGCGTGTGCTCGCAGTCGATCGAGTGTTGTAACTG
CATTTCCACAACCTCATGGAGCCATTCTTGAACTTGTTCCCATCGATTTTGCACAGTGTCCAGAGCTCTAGCATCCACATCTGCAAAGCCCTCACACTGT
TCATCGAGAAGCAACAACAACTCGTGTGTGCGTCGCCAGTGCAAtcccttcttctccatcaaaCGCAGTTCGCTTAGAGGACCATTCGGCTGCGTGATAG
CCATCCAACGAGACTGAATCCGCGAGACTGCTTCGGAGTGGCGAACGTCGAGTCCTTTGCTGCAACGCTGCTCCACAATATTCAATAATTGTGGAGCTCG
AATCAGGCTAAGCTTGCGATCCTGCATTCGAACCAGCTCCTCCAAAACATCCAGTAATGTCTGCCATTTTTGCTTCACCTGCTTCCATGCTGTACTCAGC
CCCACATCAAGACCTTCCAGTTCCTTTTCAATATCGTCAAGCACTTCTGGCGTGCGTTTGGCATGAAGCTGCGAGGCAGCCTGAATTGTCAAaagctcgt
ccagcttcggTTGCAAATTTACCCAACGCTTGTGTACTTTCATCACTGCTCCCCGATAAGTGTTTGCCATTTGTGCAACGCTCTGAGTATGTTCCATCTC
ATCAGCATTGTTTTTGCTTTGAGTTGGCGAGCTTTCCTGCAAGGAGAAAATGTCCCAAACGAGGCTAAGTAACACGGGCGTGCGCTCCCAGTGTAGCTTG
CCAATGGCTTGCATCGTAATCTCATCTAAATAACCTTTGATGGTTGTCCAGCGTCGACGTTGGGCTGGCACGACTGTGTCGTGTATACgcctgcgtgctg
cttcgtgctgcgcAATATACCGTTGTTTCCAAAGCTTGTAAACGTCTATCGCTTCTTCAAAGAATGAGCTTTCCGACACCTTTAGGTGGAGACGCAACCG
TAATTTACCCCTATCATTCACTCCAGGAGATCGCACATTGCTTCTATAACCACGCAGGTTAGTGGTGGGTAAGTACAGAAGCTCGTAGATGTCGTCACGT
GGTTGCTGGTCAAGAAGATCCATCAGCGGGATGCAAGCAGTGCCTAAGTACCCGTCGACATTGTTGCGATCTTCGTCCATCACTTTCACGCGCACTGATG
CCCTCATGATCATGTCAAGCACCTGGATAAGTTTTGtgcgtcgaagtcgctggTAAAGTCGCAGACGGACCTTCTGGTCCTCAGGCTCCAGTTCTTCTAC
CTCACGATCAAAAAATGACAGCAGTTTCTCGCCTTTGTGGATATTAACGCGGTCAtcctccgcgtccagcttatacaacttgtccagcttAGGAATGAAG
TGCTTCGTTAACACTTCGTGCAGCTTTAGAACAGTGTGTTGTACCCGATATGTACACGTGGCCACATTGGCTTCTACTATCACCACATCATCGCGACGTT
GGCTCTTATTTTCATCAACTTCCACATCAGACGACCACGGGAGCCTTCGTTCTGTCACGTAGTGTCCAAGGCCCAGCTCATGAGCGGTATCCTTCACCAA
TGATTTCGTGTGTTGCAGAGTAAGTTGCAACGTCTCAAGCGCTCGAGATTTTAGGTCGAAGCCAGAGATTTGAGCCTCGTTCGAGGTAGCAGATAGCACC
GTCACAGAGCGAGACGGAGTAGACGACTGCAACTTTGTCATTGCAGTAAATATCTGAACCTTTGTAATCTTCTGCAGCTGAAGTTCCTTATCAATCGGCG
TGCTTAGCAATGCCTTCCCTTCGCCAGAAACGGGCGGCCCAGTGGCAAGAAAACTTCGTGAAAGCTTATTTTCGTGCTCTTTCAGTGTCAATTTGAGAAG
TTCTCTGGGGCAGATAGTCCAAAAGTCCATGGACGTCTCGAGGTGCTTGGCGTATACTTCCGCATTCACACTGTACTTTTGAACGCGCTCAACACTCAAA
GAAAGTGTTCCAATCACCGCACGCTTCCCCTCAGATCCGTCCCGACACATAGTATAGATTGGCTCGTCTTTAAGTTTACCAGTACCATCCACTGATCGAG
AAACGTTGATTGATCCCATCGGAATCGAGACAACTCCCACCTTTGTTTGCGTTTTCTTGTCTCGAATAACCAGCCTCACTTCCGAAATACGATCCATATC
AATCGTAGGGTATTTAAACTCAACGTGTGGGGATCCGCTCTTAATCCTCCAAATCACCGACGCATCCGACGACTGCTTCGTTATCAGTGTACTATCGTAC
AGCAGCGTAAAAGTCGAGTTTTTCGGATAAATATCTGGTAAAATCTCGCCTGTCGAGGAGACCTCCAAGCCAAACGGAGTGGTGATCTTCTTGCCATTAG
TAGTTGTCATGTGTTTTTCAAAGTCGCTTGAAATGAGTGACACTTCCACCTCGAGACCATCACCTCCCATTTTTTCTGCGAATGTCATATTACTCGCTTC
GAATACGTTCACAAAGAGCTTGTCAAACTTAATACTCCCACTgggcacgtccacgtcggtCTCATCACCTGCTTTTCTCATGTAAGCATTGAACTTCGTG
TCTTCATTCGACACATCCACTCCAGCCACAGCCAAACCAACCGTCTTGCTTTTGTTAGACTTCGATCTTGCGTCAGCGCTTGGCTTGTCCACAGAAATTT
CGACAGTTTTTTTTGTCGAGCTTGGAAGGAATCTTACACGGCAACGCATCGATGAGTTTTCGTTTGAATCGGGGGGAGATGAAACGACAATGGCTTTATG
GAATGGAGCAAGTTTCCTtcgaactgcagcttctgccaAAACATCGCCAATCCGAAAGTGCAATTCGTGACTATTTTCGTCGGAATCACGAACATTAACC
CGGATATCATCAAGAGGCTCCAACGAAACTTCCGGGTTAAGGTCACGCCTTCCGGTTTGACTGGTAAAGGCAGCTGACAGTGCCATCCTGGGCTTGAGCG
TGCTGTCTGAAGTTGCCATAATCCACGTCACCTTTTCCACACTGACAGAGTCTGGCAAGAGCGTATCTCCTTCCACAGCAAGAGTGTCTATGGCTTGAAG
TCGCTTCGAAAATGTGGCAGCATGCTCGTATGCAGTAGCCACCGCTTCACTGATACTACCTTGGTCATTGTACGCTACGGACAGCTGAAACTTAATGTCA
ATGCTTGCATCCAACCATGACGCATCCGCCAAATCTTTATGAAGCGCCACCGTATTAACTGTGAGCATGTCCTTTGAACTTGGGTGCGTCAAATTCAATA
CCACATTGCGAGCAGGATTCTTAGCAAAATTCAATTTGACACATTCAACAACCACGCGGCACTCTGAGGATCCGGACTGGAGTTGTGAATTGTATTCCGC
ACGCAGCAGTCGTTGAAGGAGTGGCACGACCGAGCCGGGTGTCTTTCCCAACGTAGCCAAACCCAGTTTCTTGAAAAGCGCCTCCGACTCAGAAGATGAA
CACATTTGCAAAAGTCCACGAACTTGCACTTCTGGTCGCGGCGCTACTACCAAGTAGAAACAGTTTTTCTTACTGAATGGCGCTGTTTTTTCCTTGGAGG
ATTCGTTGTGCATACGACGTTTGTCTACGGCAGCGTGCACCAGCTCAAGTTGCTCTGCTTCTCCCCTGTTCAAAGTCTCTCCCTTGACAAATCCGTGGTA
TTGACCGAGGAAACGCGGTTGGTTTTTATTTCTCTCCGAAAGTGCTGTTTCCATAAGTTTGTTCGTCGTCGCATTGCGTACTTGAATCGActtcacagca
gcaggaagtatCGCGTACACCTTCACAATTTTGTCACTACCCCACCAAAGATCACCCAGTGTTCGATCCATGCTCGTTGTAAAATCGGACAACTGATGTC
CTGTTTTATCCAACGTCGGCAGACTTGAACTGAAAACAGCGCCAAGAAATGCTGTATCGGCCCCGAAAAATCCCTGTCGTGTCCGTATATGACTGCGTGC
CAAGTTATTGACCACCTCGCCGTTCTCAAGGCGGATGGAATACTTAATTGCAGGAGGAGGGCCTTCCGaaactgctgctgaagcgtAAATGCCTGATATT
CTTCCATCATACATGGTTTCATTGCACACTGGGGTCAAACGACTTCGGCCCACCTCTCTGGCGTCGGCTGGCTGTTGTCCATCGATATATACAACGTCAT
ATCGCGCATCACCATAACTGTACGTGATCCTTCCAGGACGTGTTCTACCATTAGTAGAAGTCAAAGAGCTCTCGGGGGGGTTATATTCCACTCCAGAGAT
ATCCGTGATCGAGTGACGCTTGGTCGAGTCGTCTTCGGAGGTTACAATTGAATCATCACTAATCTGCACATAGTCTtcgttctgcagctggaactTCAAG
AAATCCCCCTCTACCTGCAAGAACATTGCACTCGCCGCCCGGTTCGTTTTCCACTCTTCTCGTGGCTCGAGACTGTCGATATATTCGACCAAGTACGGGG
TCTCAGCGTGCTTGGAGGTATCGTACTCTTTGAGCTTTGCAAGACGCTCTTGGGGTACTTCTGGCAAGTCACGTTTGTCTGGCTGTTCTGATATTTTGCT
GCTCTCAACTGCAGTTTCGCTAGCTTGTTGGCTTTGTCCACTGGAAGCGTCATTCTTGCCATGAACACCACAAAGTTTGATATTGAAAAGGCCGGCACTG
CATTCCTTGACTATTCGTGCCCCAACAAACTTTCCGCTACGTAACTGCACGTCCACAGCGACCCCAGCATGCTTATAGAAAGGTAATTTAACAGTGACGC
GGTCGTCAATGCAGAAAGGGCTCAAACGATCTTTGCTATTGGAATCTGTGGTAGTTGAGACGACAATTCCATTCCCACAGCTGGACTCACCACTTAAAGT
GGACATATCAAAACCAGTCCATTCGCACTCCGTGAAAAGGGCTTCGATCAAACGTGGTGTTTTTTTGCCGTGAAAATTTCCAGTCAAATAGTCTTTGGCC
TCAGCCACTTGCATCAATATGCGAGACCATCGAGTGAGCAGAGCATCCAAAGCAACCACATTAACATACGAAAGACGATCGTTATCTCCACTCAAAAAGA
CGAGTTCAAAGACATAACCCAGAAGCTGGGGTGTAACTTTCCAGTGAAGCTTCGAAGCTTGGCTCATGACGCGTACCTgtgcgagcagctcctcaGCAAC
ATTGCGACCTGGGATCAAGTTTGCCTGGCAAGTGTCCCACAAAAAAGTCTCTACATCCTTATTCAGTTGCTCTAGGTTGTACCGTCCGCCACAATGGTTA
AACGTTCGGGAATCAAACGTGAGTCCAACCAAACGGAAGGTGTCAGCCAAGAGTCTTCTGACGCGGTCCGCTCGAAGGATTCCGATCAAGTTCAAGTCAA
AAGTTAAAgtcgccgtctccttggAATCACGTTCTGCCAAGACTAAAGTTTCATCTCGAAAGCTTGCACACTGCATCGGATTCTTCATCGAGAATTTAGG
CTTGCCTTCCACTTCGCCATCTGCCTTGCGATTTCCCTTGCGATCCGACTTGCCAAGTTGTCCCTCAAAGGCCCTCCCAGTCGACTCTGAAACCAAGCGA
ACATCAAAATAGTCCACTTTCGACAAATCGTACGTACGCCCAAGGATTTTGAATGCTGCTCCATAGTAAGACGAGCTTGATTGCGGTACTTTTCCTGCCT
TTTCAGCGTTTTCTAGCGATGCAGCTGAGCTGAGAAGATCGCTGAGCTTGAATGAATTCCCAAATCCGAGGTCCTCTGCAGCAGGGTCATACTTGACTCT
TATACCTCCTTCACCGTGAGGCTGAAAGTAGCAGGTATACTTGCTCCAGTCTTCTTGAGGTCCAGCATTCTTGCTAGCTTTCTTGATCGCTATCTCTGCC
GAGTGAGTTGTTTCGAGCCGCTTATCGTTCAGATCCGCAAAATTGTCGTTTCGCATTATCTCCACCACGAACCGCAACTTTCCGAGCACCCCGTCTGGCA
CAGGTGCCTTCTTTGGATTCAACTTTCCAGACACTGGTAGGAGCATAGCATCTACCTCAACGCGATTTTTATCatccagcttcagctcttGTGCATCAGC
TTTTCCGTAAGCATCCGCTTGTTTAAGTACAATACCTCTTATGTACCCTGTTTCGCTTCGTTGGAACTCGATGGTCGCGCAACCTAGCGGATCATTCGCC
GACGTCGCATCGTAGTCCATTACGCGCAGCAAAATTGCCTTCTTGTCACTAAGCATCGTTTTCTCCGTTTTCCCCAGCAAGAACTCCTGGTTTTCCCATT
TGGGGTTAAGTGTTTTCATCTTGATGTCCGTTTTCAGACTCGTATCACGCTCCTTCGAGTCTTCATCCAACAATACGATTTCCACAAATGGGTCACTTGT
GAAGAGATCTGCCACAGGTAGATGGCGTCCCTCCAAGATCGATACTTTAACAAACGATGGCTCTCGCACTACAGCAAACGGGAGCTTCGCCTTAGTAGCT
TTTCCCATATTGCTCCGCTGGGGCGAGCTGTTCTTATCTTGCAGTTGAGGCGTTGATTCCTCTGTTTTGATGTCTTCAGGGATCGGGGGGATCTTAGTAC
TTCGTTTCACCTCTCGCCTTTGAACAAGCTTGAGTTCCATTCGTATCTGGCCGAGATTTGTCCTCTGAAGCATGTCGCTAGCTGGTGCAAGAGGGTACCA
TGCATCAATCGTGCGGTGGGGTGAGATCATCTTTGTATGGATTTTGAGAATGCCTAGGGGCTTGTGGCGGTATTTGTGCTTCACCATTCGCGAAACACAA
TTCTCCAGGTCAGTCACCTTGAACAAAATGTTGAGATCTGCGCACTTATCACTAACTTTTTGGGGGTCCAGATCACCCTCGTTCGTGCGAATGTGCTCCC
GCATTAACCCCTCCTCGACGATCCGTTCATTAGCATGACGGTACTCAACATCGTATAGCAAAAATACGTCACGCTGCGACTTCGGTAGCCTCATCCACGC
GGCTTTGTCAGTCACCTTGTACTTCGCGAAAAGCATTGTTAGGGCTTTGGGTACCTCATTAGCGTCTGCCATGTCATATTTTGTCTTGAACGGATAGTTT
TCGTCGGTAAACGGAGTGCGGATACGAAGAATTTGTCCAGAGTACAACGAGTCTTTCTTGAAGTTTGCACTATACACAGGGTTGGTTTTCGGGTTTTTGC
CTTTGCCATAATAAGCCATCACCGCCTCACCTTCTGTGCCTGGCTTCTTCAGCTCACTCCGCACTTGGGCACGTAGTTCCCGGCGCTCCTTGTCATGGTC
TTGGTGTGATAATCCCTTGTCGTGACCGAATAACCGATTAAGCAGCCGATGGAAGCTTCCTTCGAGATCATTAGGATCAAATTCTGTGGCATGTTTGTTA
CACTTTTGCTGCAGAATGATTGGGTTTAGCCGTTTCATGAGTACCTCCTGACCTGGTCGCATATCAATGCAGACGCCTGAGCGCGCCAGTGCCTGGATCC
ACTTCTGAGTACTTGAGGTCTTTACTTCGATGACTTTGTCCCCGTTTTTCCGCGTCTTTATCATTTTGTCGAGAATTTCGGGGGTTACTGGAACAAAATC
TTTCGAGTTTGGCTTCTTAACGCACACCGTAGGGTTCACGATGTCCATCCACCCTCCTTTCGCATCATTCGAGAAGTTGTAAGCAACTTTGCAAACTGCG
CTCGCCATATCGACAAAGGCCATAGGAGCTGTCGACGTTTCTTTCTCGTAAATGTACAAGTGCCTGCGACTCGGTACGAAGAGGCAATATTTCCAATTCC
ACAGAATGTTTTCAACAACTTGAGCATGACCTTGTTCCTCGGGACTATCAACCGAATCCTTCTCCTGTTTTTCAACAGCATGTTCACCAGATTTCTCAGC
TACGGGGGGCATAAGCGAATCCTTCCATCCCTTGACGGCGAACAGCATATTGGACAGCATGGTGTGCATACCTAGAAAGCCGTCACAGTGCTCTGTGAGC
TTTTTCGCGTAGGTTTTCACTCTTCGGGCGGTGGCCTGTTGCGGTAGCTCATTTTCAATACTAGCGCTGCTCTTCTCAAACGATTTCGGCGACGATAGGG
CCTGGTCACGGTAACAGTCAACTTCCTGAACGAGATCCAGGGGAAACAAACTACTTTCACGTGATAGGTTCTCCATCCACATATCGACTTCGCGTAAACG
GTAGAAACGGTCTTCTCGATATTCCATTAGCACGTGTCGCTTGCAAAAGTCATCCAAAGCAGCAAATCCGGGAGTAACATTTTCCACAAACCCAGCAGCA
CATAATGCACTCATCCATTGCAATGCATACAAATCGTGCGTTGGTGCTTGTAGTGCATCAGGATCATATTCTAGGTTCTGATTTCGCCAGCCCAACTTGC
ACGAAGACAGAATCGTGGAATCGTTACAATACTGTTCCCATTTGTCGTCCCACAAAACCGAaggtcgacgcagcagccaagcGATTATCCCTTCACCTGT
GAAACTCCTCGAAACCGAGAGGACTAGTGCACTCGTCTGGTCCCGCATGAAAAAGTTCCCATTTTCTCGAAGAAGCTTTTGCCGCTCTGTTCGCAAACGC
ATCCATTCCTCCCGAGATAGGTCTGAAGCAGGGTAAATGCGTGGCCCGGGTACTCCTGCCAAATCCAGGAGCTCATTTTCTAACCCGACAACAACATCCT
TTCGAACTTCGTGCGACAGCTTGTCCATTGTGCGTCCAACGAACTCGCTACCTGGGGTAGCATTCACAGTATGAACCAGGCGTGATTTCCTCATCTCTTC
ACGTGCAAGTGTTTCAAACCCTTCAAACTGCTGAATCTCGCGCAAGATGCTTACAATCCGTTTCATaacgatgacgaggacggtATGCAATGCATCGATC
TGTGCATTTTCAGTTGGTGATAGCGACGTGCGGAGAAGTTGCCGTCTCTCAATCCAAGTCACTCCCCGAGTATACAGTGACGACGCctgcgcttcaagct
gaagtTGTTTTTCGTACCACGCACTTAGCTCGAACAAATGGGGTTGTTCGAgttcttctgctgcagcaggagcctcAACTAGCTTCACTTTATAATCCTC
GGACGAGGTTGTAATGCGGACGAACAGAGACCCCACAGACTTGTAGTACGGGACGCTTGCAGACTTGGGAGGAACGATTTGCAGGTGTAAGGTTTGCTGT
TTATTCCGCAGCATGGCGAGATCGATTTTCGCAAACCCCAGCGTTACATTCAGCAATTCAGCATCCTCAACTCGAGCCTCCTTCATCCcctgtttcttct
tctttccCGCATCAGTCACATCGTGTTTTTCGACTTTGACTTTAACATCGACTCGGATTAAGATGCTTGAAGTCTGTTCGAGGATCTGGTATCCCACCTT
AGCTTCATCTGGGTCAACAGGTTGGTATCTGTATTCCACCTTAGTTTCCTTTGAGTCGGTGGGCTTGCCATTTGTATCTCGAGGTGGAAGTTTTTCCACC
CTACCAATTACCAAGGGTTGATTCTGGAACAAGATTATGCCGTTATCTTTTTGTGCCTTGGCAGCTACAGCCGTCGTCCCATGACCCACAGTTGCCGCCT
CGTGGTCTGAGGTTTCATCCTGGACTTCAAGCGTAGCCTCAAGTTGCTTGTCGGTtttccagctccacgttgaCTTCGGCATTGTTTCACACGTAAACAG
CTCCCCCCGATCGTTAAAATAGCAAAGATTGGATGCTTTTTGCGTCGGCTTTCCAAGCAAAGTGACTCGGCAGGCAGGCTTGTTGCTCTTATCGAGCTGG
CTCACCTTCTGCATTTTTCCATCCTTGGTCATAGGCAACACAAGATCTGACGCTGACAAGACATCGATTACGATTCCAGAAATCATGTGCTGCATCCTTG
CCCACCTCTCGTTTTGTTCTTTCATTATATCCAAACGCCTGGCCATCAACATTTCCACATTTTCCGTCAAGCTGTTCACTGGGACGAGTTGAGTAGGCGT
CACAACATACCGTGAGCTTCGTTTGGCAGAGTTCGCGCTAGCTGATACCGCATTATCTGCAGCCACGTCCAGTCTACCGTCACTTCGTTCCGACTGAACG
ACTCCTTTCACATCAAGCGAAATCAGATTTCGAAGCTCATCAATTGTATCAATTTCATCATCGAAGCGGACTTCATATTCATCGTATGGGAATGGGATGT
ACTTCTGGATACGTGCGGGGTAAAAGCGACCGCCGTCCTCTCCGCCGCGAAAAGCCAAGACTTGCTGTCCAAATTGGAGAAGCTCGAAATtatcgtcctc
cacctctcCAGATGGCGACAGTTTGTGCATTTGAAATCGCTTAAGGCACACATCCAGTTTTTTTTCCGTATTGGTAAGCAGGTTTGACAGAACCTTCTCC
TGGTCACTCTCCACGTCCCGCTCGTACAAGTGAAGAGAAAGGTAGGACACATTGGTAATGTCCTTGATTTTCCCAAAAACGAAGTCCTGGACCGGCCAAG
ATGGATCGCGTGCATTGTAGACAGTTAGACTTTGAATTCGCTCAGTATCTTCCAGTGTCCCGTCACGACGAACAGGAATGACCGTGAAGTAAACATTTGT
CGCGTTTCGTAGCCGGCGAGTATTATTCTGAGCCTTTCTTGTAGTTGATCCCTCACTAGTATCGAGTTCAGATGCAGTGGGCGCAACGTTGGTATGATCA
CCAGCTGTACTTGAGACCAACAGGTTCCGAGCCTCGTGGACGCGCAACTGAAGGACCTGAGTTTCAATGCTGGGATATTTTGCGTCACTAAAAATCCCAG
GATATGACAACGAGAGCGAAAACTTTTCCTTGCGCCACGTCGCTGTGTTGCCATTGCCAAGTACTTTTGAAGTTGAGGTCTTTATTGGGGTCCCAAGCTG
AAGAATCTCAGTCGTTTCGTCTTCAAGCTCAGTTCCATCGAAGTCCTGCATCGACATACTCAGATCCATCGAGACCTCACTTTGGATGTTGGCCTCTGAG
AAGCTCAGAATGCTCAACGATTTCTCCATCGGAACATTAGACACGCGCTGCATCAGCTCTGCCAGTGCGGTTGCATTTCCTACTACTTCCGTTTTTATGC
AGAGATCTCCCAAGTCTTTGGCATGCTTTTTCATCCAAGGCTCGGGTTTCAATTCATATCGCTTCACCACTTCTCTCGAAGAAATCGAGGTAAAGTTTGC
TGATGCCCGACACAAATCGTACAACGGAATCTCCACACGACCAAGCGGGGTGCTCCTCCCAATGTTGTTGTGATCCTTCACATGAATTATTAGCGATCTG
GCCTCCGAAAGTGGGACATTCTGCGTACGCAAAGGAAGACGATCAAAGAACAGGTCAGTATAGATGTGTGTAGAACTTAAGAACAAGCTGTTTCTACAAC
GTACATTGCCGAACATGAAGTTCTCGTTGGTCCACACAGGGTTTAGCGTCTTTGATATCACCGCGGTGCGCTTCTTTTCCGTCTCGATGTCCTTTCCTGT
AGTGCAATCAGTGATCGAAAGTGTGCAATACGGGTCACTGTAGCCGTTCATATCCGCCGGACTAAGCCCGTGCCCCGTGCGGATTTCTACCTTCAGGATT
GGTATATCGGGGTTAATCTCCAATGACTTTTCCGATCGCATCTCGTTTTTGGTAAGCTTTGTCCGATGCAATGATACTTCTGCGTGGGCACGCTTTGAAA
ACGCCGTGTTGCGGACGTcacttgcagctgctgcaattCGTTTACTTTTCAGGGGAGACAATGGCGCGCTTGTTCGCTTGCATTCCTCAACACATACGGA
TGGATCGAGCTCAATAACAGCGTACGGAGTAGCCGTACTTCCTGTATCACCATGCTTTTGGCTCTGTTTGAGTTCAGATGCCTGAATAACCGTCACCTCC
AACAATGCTTGTCCTTCTAgaccagcacgtgcttgAAAGCCTTCGTCTGTCGACGTTTTCTCTTGATGAGCACGCGAAATTTGACTGTTCAGGTAGTGAA
TGCATCCGTTGATACCATAAAAGCGCGGATCACGTGCCTGGTAGTCGGTCACCGCACACGGAATGCGTGCTCCATCCAGCTTACAAGCTGCATCATGTAG
CTCAAACTGGGCATTTTCAtagtcgagctgctcgatcgaCTGACTGTGTGCTTTCAGATTAAGCTCCTTGGAGATTTTCATTCGACGAGCATGTTCCCCA
CGCCTCTCACCAATCAGCCAGATTTTGAGTTGGATTTCGCCGAGATTTTCGCGGATTGACATGCCTTCCTCAGGTTGCAGCGTGTGCCACTCGGTCCATT
TGTGCGCAGATAGCTGATCGAGGCCGATGAGAACAAACCCAAGAGGATCATTCCGGTTTGATTTGTCGTAATCAACGACCCTTAGTTTGAGACTGGCTGC
CGTCTCAATATGAGCGATCAGACCAAATACGTGGTGCTCGTTCGCCCACGCAGGGTTACGCGTTCGAAGCATGGTGGCAGTGGTAGCGTATTCGCCCGGA
ATGGGCCTGCCGTGGTCATCCAGCAGAGTAAGCTCACAATAAGGATCCGACGAGTTGTTGAGATCAGCACTGATGAGATTCCTCGCAGCTATAACAGTGA
CCTCCAAGCGGTTGTCAGTGTGTTCACTGCTCACCGTGGCAACAGGACTTGTCGGCACGAATTCCAGCTCCGAGCTGTGAAAGAAATCCACAAGATTGGG
TCCAGAAATGCTCATCCGGACGCGCAACTCGCCCCAGTCCTTGATTACATGCTCTTTCTCGCTGGAGTTCTTGCGTCGAGGTGAAGACGAGCCGCCGGTT
TTCTTCGGTGGCTCCACGCGAAACCATTCATCAATCGGTTCTGACTGGGCAGTGCTGGCTGGCGACATGCGGAACCTCGAAAATGGCACTTGTACTGATC
CCAGGCTGTCGTGACGCTTGAAAGTGTCGTGGTCCAACAGGTCAAATCGAACTGCCTTCACCGTGTTCATGTCGACAACTCGACCAATCTCGAACGGCGC
TTTCCATGCAGGCTCTAACGTCGCTGGGATCACGTCTGTGCGTTTCTCCTCGATGTCGATGATCTGTCCATCTTTGCCAACCAGTTTCACGACGCAGTAT
GGATCACTTTTCCCGTTCATATCGGCGGCTTTGAGCTTGCGAGCCTCCTCTACTACCAATTTGAGCAGAATTCGGGAGGGGGgagcaggtggtggaggtg
gttGCGGAGGCATCGGtcctgctgaaggagcagggGCCGCCTTCGGCATTTCGGGTGCGGGCGTGTGCTGTGCCACATCCGAAGTCCGGCGGTAAGCGTT
GTAGATAGCTGTGATCCACTCatccttctccacgtcgttTTCCGCCTGCATGTATAGACTCGGCTGCCCCGGCGCAGGCTGGAATGCGATGCACAACGCG
TATCCTTGGTCATTGGTCCGGAGCACACTCGAGTCCAGCGTCAGCTcgtagcggcggcgtggcgctgcgtcttgcGGCGTCTTGTAGTACATCAGCTCGG
TGCGAGTCAAGCGGAAGTACCTCTTGCGCCAGTTCGACACGATCTTGCCTGGTCGACTGCGTTTCAGGAGCCATCCCTCCTTGATGCAGCGTTGGTCACT
CATCGCGGGGAGATGGCAGTACTCTTCCTTCTCCTACTAAGCGGTTTGTCTCTCTTGCGCGGTTCCTGACTTCTTCACTCGTTCGTCTCCTGCGCAGGGG
ATCGCTTCTTCTCTTCTGAGGTGACCATTGCCTGCAAAAGATCGCGATCGTCTTGAAGCGTCGTCGCGTCCCTCCATCTGCAATGCTTCGGCGGTTACTG
ATCCCGAGACCAACTTG