Description :
From Genome Similarity Track
Location :
Scaffold_379:5682- 7139
Sequence
1457 bases(100 bases per row)
CGAATACGACTCGTTGGTCAACAACGGCACTTGGACCCTGGCGGCGCTGCCCCTGGACGCAAGGCGTTGCCTTGCAAGTGGTTGTGGCGCAAGAAGTTCG
ACGCCTTGGGTCGCTTTACCAAGTACAAGGCTCGCCTGGTGATCAAGGGATTCATGCAGCGTTACAGTCTCGACTACTAAGAAATCTTCGCGCCGGTGCT
TCGCTACAACACGCTGCGCTTGGTCCTCTCTTTGGTTGCGTTTCACGGGTAGAAGATCCGGCAAATGGACGTCAAGACAGCGAGCGTTCTTGAACGGACT
CATGGACGAGGACACCGAAATCTACATGCTGCAACCGCCCAACTTTGCAGTGCCTGGGTCCGAAAGTCTCGTTTGCAAGCTGCTCAAGGTGATTTATGGA
CTCAAGCAAGCCCCAAGATGCTGGTACCTTACCCAGCACATGTTCCTCGTGGAGATCGGTTTCGAGAGTTGCGCCAAGGAAGCATGCATGCCTCTACGTC
AAAAGAGTGGGAGAAGCCATGGTGCTTTTGACCGTCTGCGTTGACGACATCACTCTCACCGGCAACAACAACGAAGAAATCGAGAAGGCGTGCGACGACA
TCAAGAAGCGCTTTGAGATGACCGACCTCGGCGAGCTCAAGTCTATCCTTGGAATCCAAGTTGAAGTCAAGACCAAGGTGGTGACGATGCCCCAGCAAGG
CTAAATCGACGTACTCCTGGACAAGTTCAAATTGGTTGAAAGCAACCCCGTGACCACCCTGGAAGTCGTCGGCCATGTGCTCAAGCCAAGCAAGTTGACG
CCAAGTGAAGTGAAGAAACTCGACCTCCCGTACAGCGAACTGGTGGTCGGAAGCTTGTTGTACTTGTTCACGTGCACCCGGCCGTACATCGCCAACGCCG
AGCGAAACCTATCGAAGTACCTGTCGTGCTTCGATGAGAGCCACTGGAAGCAAGCCAAGCGGGTGTTGCGTTACCTCAAGGGCACCGGGTCTCTTTGCCT
CAAGATCGACTGCTCAGGGCAAGTGGGAGAGTTCCAAGTTAAAGCCTTCTGCGACGCCGACTTTGCCAACAGTGAAGACCAATGATCGATCAGCGGCTTT
CTCGTCATGTTCCTCGGCGCAAGTTTGTCGGCAAGATCAAGGAAGCCATCGATGGTCGCGCTCTCGACCGCCGAGGCCGAGTACATTGCACTTTGCGACG
TGGTCAAAGAGTTGCTTTGGTACATCGGGCTGCTTGAAGAACTGGGGTTTCCCCAAGGGATATTGCTGTCCACTGCGACAATCAAAGTGCCATCGCTATC
ACGAAGAACCCCGGCCACCACGAACGCACCAAGCATATCAGCACCAAGTATCACTTTCTGCGCGATCAAGTGGAGAAGGACCGTATCCAAAATCTGCCCG
ACGAAATTGATGGTGGCCGACATCCTCGCCAAAACCATTCCGCGAGAGCAATTTGAG