Description :
From Genome Similarity Track
Location :
Scaffold_69:56819- 59692
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014663Protein of unknown function
Pytul_DAOMBR144PYU1_G014662Protein of unknown function

Sequence
2873 bases(100 bases per row)
TTAAATATACCTCACCTTCTAACTAAGAATCTCAAATACTCTCGAGTTCATGAAATATGCAGAAGTACTGCTGGAGCGTTCGATAATGAAGCTTGCTTAT
TGAGCAATGATCTTCCAGGTGATGTAACGCTATGTATGCCTGCTACACCTGCGATAACACGACTTAATCGCCGTGGGTCACAACGGACGATGCCATGTGT
TTCGAGCGCTTTTTGCGACGCAAATTGTCCACTGCCATGGCCAGCAATTGTCCTGGAATCAGCTCATGGTGGAAATATTCGAAGTTACTCTGCTCAATGG
GAATGTTCCCGGATATATTACATATTTAAGTTATCGAAGTGAAAAATACAACGTAATATACCGTTCGCACATTACTAATGGAAATATTACGAAAAATTTT
GTCCTCTTTTTTAAACGTTAATACCTTTAAATACAGTTTTTAACGCTACTAAAATGCATTGCGTTAAATACTGTGACAAAAAAGACAACACTAGATGAGC
ACCACATCTATACTTCTTTCTCGGAAACAACATGAAATAACATTTTTATTAGCCAATCAGAGATTTCTATGTAAGAAAACAGGTTCTGCCAATTCCACCA
ATCAGTGACACGAAAATAATATCAGGTGGAGGGAGGAAAAAAAGGATCAGGAAGGGAGAGAGCACTGTCAGTTGTAGTGACTAAGCAGTCGATGTCGATG
GCGATGGCAAGTAAAGCACCATGAACGGCGGCGCGGCAAAGGTGGAATGCTCTTCTCGCCGTACTCTAGTGCCGAAGTCAAAGATGGCAAAGCACCGGAA
GGTTTACAGCAAGAAGAAGCTCCCAGAAACGAGTAAAGCAGTCGATCACGACTCTTACGTAAATGTAATGGGCTATACCTAGCCATTACATGAAGGTGCG
GCTGTGCCCTACTTCAGTGTTGGACACACCACCTTCAGCGTGCATTGTGATAGCAAATAACAAAGCGATAACGGTACAACAGATCCCATATGCACGTGTG
ACATCATCTGATGATGCCACAAGTATCCATGTACTAATCAAGTACAGAGTGATGATTCCGACTTGGGGAAACAACACTGGTGATGAGACCAACGTGTCGC
TACCATCTGAAGTGAGTGGCTCCCGCCAATCACTTTGCAGGGAATCTCCGCGGTACTTCAAGTTCAAGTTTCCAGCAGATCCCCTAGTTTCAACCTCAGT
ATACCCAAGGTTTTATATATCAGATTCATAGGTTTTATTTCTGTATGTGTAGGTTTTAGTTGTAAAACCTCTAGGATCCCTAGTGGTGTTTCATATGTAG
TGTCAGGAACCATAAGCTCATTTCAATTCAGTTGCATTTTTGCCAAGTTCCTCTCAAGTCTTCCTCTCAAGCGCAAGCGTGCGTGCTGTGTTTGAGGCTG
TCTTGGATAGCCTCTTACACAAGGACATTGCCGCAAAGTTTGGTTAAATGGGGCCACCGCAAAACTGCGGCCACCTCTCCAAACAGCTATTTTTTTGTGT
CCAATAAGATGAGAGTGTTTCTTTTCTCAATTATGTACGAAAATTGGCAAAATGGCAAAAGTCGGTGGTATGAAGAAAAAAATGGATTGTGTGATACAAA
CAAAGTCGTTTTCGAAGTGGTGACCAAGTGCACGCATATATATCACACATAAACCCAGCTGTCAATCTGAGGGTACCTCCGCGAGAATTTGTGGGCACAC
GAATAAGTCTACGTAATGCTGAGGGGCCGTGAGTGGTCGGGAATGAAAGATTAGCTTGCGGCTCCCGGTTGACCCGTGGAATAGTGCAACCTGTTTTTTC
GCGTGCGTAGCGCAATGCACCATGCATTCAGACTGCCCTGCGCTCGATGCACACAATGCAAGCACAATGTCATGCAGGAGAGCATGTTTCAAGAAGCATA
CGATGGTCCTTCCGGGAAAAAAGGACCAGCTTTATTGAATGCGTTAATCACTGTTTCTTTACTAAGCTCGCTAAGTGATTGAATAAAATGCTCAAACATA
TCCTTACGTCTATCACTTGCTGTCTGTGGAGGTTTAACCCGACGGTACTTCTCCGAATAGAGCTTGTGCACACGATGCTTAAATGAAGCCATTAGGCCGG
CATCTAACAGCTACGCGATACCTGTCGCACCGGGGGAACATGTTGAACTATCGTCCCGAGGTCAGCCAGCGCCGAAAGAACCGCCTCGTTCATGTGAACA
TGGAGCCTTTCCAGCAAAAGGATGCAGGGTTCTGTCACAACAAACTTCCAGCTTCTGTCGATTCACTCGAGCATCACGCGCTCATCAAACCACGCCTTCT
CCTGCACAGAAAAGCTGGCAACAGTGTCTAGCGCAAAACGAGACACTTCGTCCTCGATGATGCCTCCTTTGACACCCTTGTAAACAAAGTGAGGGAAGGG
GGGAGATGCGGCCATCAGCACTTGCGGTAATCGCCACTGTGCACCGAAACGTTTCACTTCCTCCTGCGCGCGCTGGAACAATCTTTGCACCTTTTTCTTC
AACTGTAGAACGCGCACCAGCTATTGCAAAAATCGCAGTTTGGTCCATGTTGAACGCCCGTGCGCCTTGAACAAATATGTGAAGACGGATCGGCCACGTG
CTGAAACATTGTATCAACAACAGCTTGGACAAAATCCACACGCAGTTTTTCGAGATCCGCGCGGGCAGTTCTGCCAGAATGCGTAATGCGCCGCATTGTA
AGGCCAGTGCGGCACATGAATCGTGAACACCATACCTTGCACGCTTCATCCGTCGCATCAGTAAGCAAATCGGACATCAAACTTCGTGCGTAGTCGATGA
TGTGCTGACGAGTTACCACGATCTCGCTGCGACGCAAATCCTTGATATGTCGAACGAAGTCGTCTTCAATAGG