Description :
From Genome Similarity Track
Location :
Scaffold_13:5681- 7779
Transcript NameFunction/comments
Phyke_g910transcription elongation factor SPT4
Phyke_g911mitochondrial-processing peptidase subunit alpha, putative

Sequence
2098 bases(100 bases per row)
CGTCACAAAGTTATTTATCCACCTCGAGCTAGCTCTGCACGCGGTAAGGAATGTTCCGGTCCTCCAGGAAGCGCTTGATCGAGTCCGGCAGCTCTCCCGA
CACCGACACAGCATAGATCCCCGGGATCAAACGAACTGCCAACCATAAAAGCACCACAAGTACAAGAAAATTAGTTCGCAACAGTTGCAATGCACAGTCT
AATCTACACTTCTTTACTTACCAATGCGCTGCCACTTGGCCACCCAGCTCTCTTTGGGCTGCATCATAGCGATCATCCtgcgcaacagcaaaaaacaGTA
ATCTATTAGAAATGTTATGATATAAGTTGATATTGTGCGAACAATATCGTATTTACCCCTCGAAGTAGGCAGACGTGCACTCGGCCACGCGCTGGCGGTT
GTCGGCCATCTGCAGGAAGGCGCAGTTCTCACAGCCAGTGTCATAGAACTGCGTGAAGGTCTTGATGAGCGAGCACGTCATGCAGGCACGCAGCTCTCGG
AAGGTGTTGGGGATGTCTGCGTGCTGGAAAGactcgtccagttcctcgtcgtcctcgtcgcgCATGCGGCTCATGGCTCCGTCCAGTCCACAGCGAAAAT
GTATCGAGActgttttttgtttttttaaacAAATTTATTTGTTTTAAACTCATTTGATACAGTTTTTTTTACAAAAATCGAATTCTTTCCCTCCACTTAC
AAAATTCAATAATAATAAGTTTTAATATATTTCACTTCTTTTCAGTAAGCTTTGTCTTGTTTTGGTGGTGAGCAGCTTTGTGCGGCGGGGAGCCGCTCAG
CACAGAAACGCGTTGGAGCTTCACCCCCATTGCATCCCGTCCGCCTCTCGATCGATATGCTAGCGTCCTCCAAGCTTACGGTGCGCGCCACGCGCTCGCT
GTTCACCAAGGCCAGCACCATGCCCAGCGTGGCTCTGAGCGAAGAATTCCCTTCGGTACCCAAGGCCCAGCCCAAACCCGCGGCCGCTGCCAAGCTCACG
ACGTCCACGTCCTCGTCGGGCCTCAAGCTCAGCTCGGACGACCGTAGCGCCACTGTCGCCACCATCGGCGTGCAGCTGAACACCGGTTCGCGTgacgaga
cggaggagacTGCTGGTGTATCGCAGCTGTTCGCCAAGCTGGCGTTCCGTGCTACGCAGACCCGCTCGGACCTGCGTCTGTACCGTGACATTGAGGCCAT
TGGCGGCGTCGTCAACGCCCAGGCGGGCCGTGATTTCGTCCGTTACAGTGTCAGTGTGCTGCCTGACcagctggaggctgctgccgacATCCTGGCGGAA
ACGACGCTGTCCCCCAAGTTCTCTCTCTACGATGTGGAGGAGCAGAGGAAGATCGTGCAGGCTGAGTTTGAAAAGATCGtggatgacgctgaagcaTCTA
TCATTGAAAGCAtccacgctgctgctttctACGACGATGTTTCCCTCGGACGCTCGGTGGCTGACGTCGAGAATCTCAAGGCTCTGAGCCCCGAAGCCGT
CTGGGCTTTCTACGACAAGTACGTGAACGCCTCCAACGCTGCTCTCGTgggtgctggtgtggctCACAACACACTGTCCGACCTCGCTAACCAGTACTTT
GGCTCCATTGCCAAGGGCAACAAGGCTACTAGCGTCAAGGCCAAGTACGTTGGTGGTGAGACTCGTGTCAAGAAGGCTGGCAAGTTCACGCACGTCGCTT
TGGCTCTGCCCACTGCTGGCCGTGAGTCGGCTGACTTTGGTGCTACCCAGGTGCTGCGCGCTTTGCTGAACCTGCGactcaacaacaagaaggcgTCGGC
CTTCCTGTCGAGCTACAGCGACGCCGCTCTCGTGGGCCTGTCGGGTTACGCCGCTCACTCGGAGGCTGGCGCTCTCGTGGACTCGTTCGCGGctgagctc
aagaaggctgcGTCGGCTCCGGCTACCAAGGAGGAATTGACTACTGCCAAGACCACGGCTGCGCTGGAGGCTCTGGAGACGTACAGCACCCAGGCGGGTA
CTCTGGGCCGTGTGGGCCTCGTGGCTACCTCAGACTTCGCGGCCAAGTCGCCGTCGGAGCTTGTGGAGGGTGTGTCTGCAgccaagctgcaggaactg