Description :
From Genome Similarity Track
Location :
Scaffold_1650:568- 2226
Sequence
1658 bases(100 bases per row)
CTAAGTCTCCCTCTGACTTAAGGAGCTTTGTAGCTCCGCTACACTTAAGCACTCGTAGTCAATCTACGCCTGAGACTTTAAAGACTGATCCTCTGTGAGG
ATGGAAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGCCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAATATGTGGGATTCCTTGTATCGCAAG
GCCCGGAAGTGCTGAGTGCACGTGTTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGACAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACG
CTATGTGTCTGTTCCAGACGAAGAGGCTACGCCTCGTCCACTTAGAGTGGAAGTTAAAAACTAGTCAGGAAAGGAGGGTGAAAACCTCATCCTCTAGATC
CATGAGATTTAGATGGCCATCAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTATCGCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAATGGG
CCTTGATGTGTAGCACGTCGGTCGACTTAACGTTTCCCACATGGGAGTCGCTTAAGTAACAATTGGTACAGATGTTTTCGCCACCTAACCAGGCTTACCG
CGTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGCTAACGAACTATGTCCAAGGGTTGAGAACTCTCATGGCTGCTATGCAGTCTGACCCT
CTGCCTGAAGCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTAGCGTTGCCAGAACCGAAGTTTTTCGGGTTTACCCCTCTACATTCGAAGAGG
CTGTGAGAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGACCAGACTTGGCTGGAATAGGTACAACCCTAGCTCTGGGAGAGCAAACTACATGAGTAC
TCCGGCCGTTAACAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAATTTCAAACTACTGAGCAGCAACGTGCTGTAAGAAGG
TGTTATACGTGCGGAAGCACTAAACACTTACGGCCTGGTTGCCCTTTGCGTAGACAGCACCAGGCTACGAATCAACACTCTACCCCGAGCCAGAAGTCTG
GCATGGCACAGGTAAATGCCGACACCCCGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGTC
TTAGCCCCAAAGAGTTCCATATCTACTGGTATGGAGCGTGGATACAAGGCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGACTTTGAAAAGCCTTGGT
CGATTTTAATTGATTCTGGAGCGTCTTGCAATTATTCTCGACGTCGTTCCCTTGAGGGAAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGGGTGA
TTCCATCACGGGTCGTTTAGCGACTGGAAGTCGTGTCACTGTATCTAAAGTTCCTTTAAACTTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGC
TGTCTTGTCCTCGATTTGGACTCGAAATATGATCTCATCCTAGGTATGGCTTGGCTTGAATGCCATGAGCCATGGATTGATTGGAGGTCGAAGACCTTAG
GCGCTACGCGCAATATTCCTAGCGAAGCTTTGGAGAGTCATGAACCTACCTTTGCTAG