Description :
From Genome Similarity Track
Location :
contig_2:567953- 570981
Transcript NameFunction/comments
g572.t1hypothetical protein

Sequence
3028 bases(100 bases per row)
CCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTC
CATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCC
GTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTT
TTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGT
GTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTG
TCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTT
GCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAAACAGACATGCCGTCT
GTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGG
AAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGC
TGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAG
GATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGC
GCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAG
TACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTG
CGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACATTCAACCTTCCAGGTTTGTACTCAACCTGGA
AGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCAC
GAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGC
TTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAA
CGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTC
CCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGC
CGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTA
CGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCAT
CTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACG
CACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATAT
CACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGG
TATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCG
CTGTGCGGGGACTTCGATTCCCGCACTTGTCCTTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGT
CGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCT
TGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGC
GCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCG
CGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATAC
TCGTACGCGTCAAGACACTCAATGTCTC