Description :
From Genome Similarity Track
Location :
Scaffold_209:56792- 62205
Transcript NameFunction/comments
Hyaar_Emoy2812635coproporphyrinogen III oxidase
Hyaar_Emoy2812636hypothetical protein

Sequence
5413 bases(100 bases per row)
GGAACGTACGCATCGAGCATCGAGTTGGCACAGTCACGAACCATCTGGAAGTTATCTTCAGACGTATCCGACAAGTCATCAAAGAAGAAACCGCCAATAC
CACGGCCTTCCTGGCGGTGAGGAATGTAGAAATACTCATCACACGCCTGTTTCCACTTGGGATAGAGCTCCGGGTCGCGCTTGTCCAGCTGCGTCTTGTA
CACCGCGTGGAAGTGGCGCGCATCGTCTTCAAAGAGGTAACTCGGCGTCAAATCCGTCCCTCCCCCAAACCATCCAATCTTCTGCTTCTTGCCGTCCGAG
TCGAGATACCCCGTCTCAACCTCAAAGTACCGAAAGTTCAAATGAATCGTTGGGGCCATGGGATTGTGCGGATGCATGACGAGACTGACGCCACAGGCGT
AAAACGGCAGCTCCTCTCCTTGCTTCAGCTCCTTCCCCCTCGCTGTCATCTGCTTCACAGCAGCAGGCGGCAGCTTCCCGTGGATAATTGAGACGCCCAC
GCCCGCCTTCTCAAAGACGTTCCCGTTTTGTAAAATGCGGCTCCGACCCCCGCCGCCATGTCCCTCTCTCTCCCACTTGTCCTCCAGAAACTTATTACCA
TCCACCGCCTCAATACCGGTACAAATATCATCCTGGACGCGCAGAATCAACGCCTCCATGCGCTTTTGCAGTGGAGCCTGGACGTCGAACTCGATGCTGA
TCGTAGGAGTCTTGTCCTTGGACAGCGGCTGGTAGAGGAATGGAGAAGTGGGGATAGAAGACACACCCTCACTGCGACTCGGATCGTGCTGATAAGTGAT
GCACGCAGCGGGCGCTACTGCCGCGGTTATGCAAGGCCGAAGCAACGCGCGGACGTGACGCATGTTGGGGATGGCTGCGTCTGAAGAGTGTGAGAGGAGG
AATACCGGTAATCACTGGAGCGAGGTTGTGGCGTGTGGAAATAGAAACAAGCAGAAATATGGAATGAAATGGTCAAGTCAGTTTATATACAAAATGTTGA
GGTACAAAAATGGAGGAACAAAAGTGCGCTTTTTAGCTGACGTCAGGGCGTCTTTTATAACCAGCGTGTGCCGTATCTTGTTGGTACAACACACCAATCG
TTTATCCAGTCCAGAGGTCTGCAGCTTATCATCAAGCATGAACTCAACCAGTCCTTTATTTCAGCGAATCAGATGCTAGCATACAACCACATGGTCGAGC
GACCAACTCGTCGACAATGGCAGACCTCCTGGTGACTGGACCCCTCACGCAGCGCGATCTACAGCGCACGCGCAGAGACAACGCGCATCTGCGTACAGTA
CTGCAGCAACTAAACATGTCGGTCGTCAGTTTCCCTTCATCTGGGATTGGCAACAGCAGCGAGAAGTCACGGACTTCAGATGATGAAGAAGAGGAAGAAG
AAGAGGAAGAAGCCGATGACGTAAATATCAATTTCGACCGCGCGCTTGCCCAGCGACAGGCGCGTTTGGCTTTGGCGACTGACTCCATGGCGAGCCAAGC
GACTGGAATCGAGCTCAAGAGCACAAACGACCGCGTTGCGCAGTTCGAGCGACAGCTTTTGGACGCGGAAGAGATCATTTGCCACCTCAAAGCTGAGAAA
CTCGCAGCGCTGCGTCGCATGGAGCGACTTAGCGTGGCGGCTGCTGATGGAGATCAACAAGGGGGTTGTGTAGATGGTGATGCTAAACGGCATCGTGAAG
TGGTGTTGGAACTAGAGACGAGATTGGCAGAGCTGAAAGAGGAGTGTACCCGTGACCAGGAGCAACGTATGGCGGTGATCCGGGATCAGGAGACTGAGCT
CAAGATACTGCGAAAGCAGTTGGAGCATGTGTCAAAACAGTACGAGGAGCTACAGCAGAGACATATGGACTTACTGGAGTTGGATGAACAGGTGACGATG
ATGCAGCAACGCGTGACAAATGATGACGTGCGTCCGTTAAGTATTTTTGGAGAAGAGAGCAGCAAAGACAACAAAGCAAAGGTGACCGAGTTGCACAAGG
TTGGCATTCTTGGACGGGCACGAGCTCTAGCTGACGCTGATGCTGTGAACTCCAAGTGGCATGAAGAGCTGGTGCGCCACCCGACGCCACACTTTGAAAT
GCACTCGCCTGAGGTCGCCTACATTCTTCAAGCTTGGACAAACAACATCAAGAAGATACGATACTTGCGTCGCTGGCTTATCCAGGTGGCGATCACGAAA
GGTCCGCTGCCGAAAGATTTTCCAATGGCTGTAGAGCTACCACGGCTTCCACTCGAGGTACGCGACGGGTTTCTTACACTCGTACTCCCGCTGCTTCGCA
AGCAGACTGAACGAGAGATCCTCGCTCATTCACGTCGGTACAACGACGGCATCCATATTGACCTCCGTTTCCGTGTAGTGCCTCGTTAATTCTTGATCCA
GCGAAGTTCGAGTCCCCGTATTATTATCTCGCGTGCATTCATGGTGCCATTTATTTACCGCAGTTGCATGCCCCAATATGTACTGCATGTTTCCGTGGCT
CGACCCTTTGTGGCCAGCATTACTTGCTTAATGCGGTTCTACAGTGACCATGTTCAAAGTTCGTCATGATCTTAGTGAGTCAATAGTTTCCGAACAAATT
GACAACTCCTCCGGCTGCACTCAGTGGTCACCTTTTTACGTCCGTCTTCGAATGTACGCATGTACGCAGGTTCTACCGAGTCGTCTGTTTCTTCGAAATT
TGTTTGCTGCATTGCTGAAGTCGTCAGAAAGAGGCATATTAATCTTGCTAAAAGCCCGATGTATTCATGAGATTGAGTGTGTAGCGCTGAGTGGAAAGTC
ACTGTTATCAGCGAAAGAACAAGTCCGTTCTTCCTCTTATAAAATGACCTTGTGTTCGCTGTAGTCTATACGTGGACAATCAAGCTACATCAGGACGCAT
CCTTCAAACAATCTAAACCAGATAGTGGAGGACACCTCTGCGATAAGACTTGTACGTGATCAGCTAGCCGCGTGGACCGTCCTACTAAGATAACCAGCAC
ATCTGTATGCGTGAGTCTTGCAAACCTCGTATGACTTGTTAAGCACAGCTAATAAGCCGCTAGCAATCGTTCCTGGATGTTCGCCTATACTGCGTTTAGT
CGACGACGTAAGACGACCGAAAGGATTGCGCTGATGCATCTGTCTATTAAGCCACCATTTGTCCTCAAGAGAAACAGCCGTCGTCGACATTGTGGGTGAT
GCAGCTTGTCCATCCGCATTCAGTATTGAGGTCAACACCCTGTACAATATTAAAGCCGAAAAGGTTGCGTGCAAAATTCGGAGCCGATGTAACCTGATCC
TACATCGAGGAACGGGACATACGCGGTGGTTTTAGCTCTGTAAACCTTTCGACTATCAATCACCTGCTTTAGTGAGACAAAAAAGAGATTCATCTTTAGC
ACACGAGTGACACATGCAGGTCAAGAATATCGCGGTGTTGTCTTGCGGAGAAACAAGGAAATGGCAGTAGCAAACGACTGAGCGATAGCACTTGACTCGA
TAGACGTTCAGTTTACTTGTATAAAACGCACTGGCCACGAAACTTTACTCGGTGAGATAGACCTACACAAGATCTATTGAATAGCTGTACAGTGTAAAGA
GTCAGCGGGATCCTGGTGCATAGAGACACAACTTGATCGCCAACTGAACGCATGGAGCAGCCTCGAGTCTAGAGAAGCGCTTGTAAAGACTCGACACTAT
GGTTTTTCGCTCCATCTCCTACAAATTTAATTCACTTCATGGCGGACTGAGCGATTCGCCCTAGTCGAATAGCGATCTCCGCTAGCAGGGATATCGTTAC
ACCGTTTATGTAGGTCGGAACTCACTCGACAAGGATACTAATACCCGCGGGAAAACAGCGCCATGAAGATACCGGACAAAGAAAGACTTGTCGGTTGATC
TGACAGATCGAACTACTGTCTTGTATCACCAGCCAATGCGAAGCTCTGTCGTCGTGTGCTCTTGTTCTTGCGAACAAAATCCACAGAACAAAGTAGTACA
CACCAACGGACTCAAGTCGAGACGTAGCAGGTACCCAGAGGTCGGCGACCTCCGGAACAAGAAGGTATGTTCGATGGTGTTCCGAGGTCGAAAGAATATT
CGCAGAAACAAATAGGAACGTCGAAGTGGAACTGTTATCTAGCAGTCTGACAGAATTATCATACGGTCGGAACGCGATGAAGGGTATCCGCTAGAAAAGC
GAAATGCACGTCCAATTTGCTGTGCGATAAAAGTCCGGCGACGATTGCAGAGGTATACAGTACGATACGCGATGGCAATTGAAAGTGTAACTTTCGTCCG
GCGAGTCCAGGCCATGTCAGCCTGACGAACTGCTAACTGACAGGTCAAGTGGGAAGGCCACTAGAGCACCGTTGCGGGCAGCAGACGCTTACGCAAGACG
GCCTGTAAACGCCAAACGTTTCGCAGTCTACGCGCGCTTATTAGTTCGTAGTGCGCGACGATGGCGACACTAGCCCAGCTGATCATTGTCTATGTCGATC
ACGCATGTAAAGCTAGCCACCACCACGAAGTCGCTAAATGGACGGAGCTGGCTATATATTACACCCTCATGTATCCGATTCTCACAGTCGATCAATCAAT
TGTTCAGGTCACCTGAGTTGTAAAGATACATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN