Description :
From Genome Similarity Track
Location :
Scaffold_387:5679- 10422
Transcript NameFunction/comments
g15848.t1ETI34642.1 hypothetical protein F443_18889 [Phytophthora parasitica P1569
g15849.t1hypothetical protein

Sequence
4743 bases(100 bases per row)
ATCAGTGCTTTGAATGGAGGCCAGACTCCACTGCATCCCGACACTTTAATATCTCAATCACAACTCAATTTACCTGGTCTTCCCCAAGCTCCCTCACTTC
ACTCCTTCCATTCAACGACCTCTGATAGGTTATGAGCCCAACGACTGACTCAAGCGCAGACGACCGCGATTTCCCGCGCCTTAATGGGCGGAATTTCGTC
ATCTGGAAGACTCGAGTGACCGCCGCCCTTGAAGGCAAGAATCTGATCGGCTTCGTCACCGAAGCCGACTACGCGGGCGACGAGGACTACGACTTCTCCT
CCGATGAAGACCTCAACCCGGCACTGGCCGACATGGGGGACATTGAGGCCGCACTAGATGCCGTTGGGGCGCCCAAAGCCACCGACATGGAGGACTCCTC
ATCGAGTGAGTCCTCTTCCGACTCAAGTTCGGAGGCTGCCACCGCTGGAGACGACGGCGACGTGGAAATGGGGAGGTACAACACCCTTGATCCAGTCATT
CACGCTAAAAGCGTGATGATCTGAAGCGAGCTGAGAAGCTAAAGGCCAAGAGCCTGAAGCTGAGCTCGAGGAAACTACGGCTCGATGAAGCAAAGGCTAA
AGCCTTCCTCATCAAAACCATCGATGATCAACACGTTCTCATGGTGAAGGACAAGACTACGGCGTACGAAATCTTTCAAACGCTCTGTAGCAAGTACGAA
GGTGCTGCCATCCACGGTGACCCGTACTACATCCAGTCGTACCTGATGGCCCTCAAATACGAGGAGGGATCCGACCTCATGGCTTTCATCATCGACTTGG
AAGAATCCATGAAGGCAGCCGCGGAAGCCACGAACAGTGTGCTGAGCGACGAGCAAAAATCGCTCTATCTGTATCACTCTCTCCCAACGGAGTGGAAGCC
TGAACTAGCAGTCTGGAAAGGCAGTCGGAAATTCATTCCGTACGAAGACCTGAAACGGCACATCGAGACCAAGGTCCAGAATGAGCTAGCGCGCAATCGC
TACGTCCTCAGACAAGGAACCCCAGAGTCTAAGGAAACACGAGCTGAGAGAGCTCTTCGAGCCACGGCACCAATTCCGATGCCAGCGGATCTCCAAATCC
CCGCCAAGATGGAGACAGCTCTCGTGGCTTCATTGAAGTGCACGTACTGCCAGCGTGACAACCACGACACGGTCGACTGCTACATCCTGCAGCGCCACCT
ACGTGATGGCCAAATCAAGGCTGGTACGGTTCTGCCTGCCAACTTTAAGCTCAAGGCACCACAAGGCACGCAAAGCCATCATCCTTACAAGGGCAACTAC
AAGGGAAACCGTGGCAACAACTCGTGGACAAACTATCATGGTCGTGGAAACAACAATCGCGCTCCTAATGGAAAACGCCAAGATCGCCGTGGAAATCACA
GCCGTAACAACCAAGGCAAGCAAAACGAATTTCACGGCCGACGCAACCAAGACGCCCATGGATCGGACAACAACGAGTATGGCATAATTGCTATTACAAC
GCTCGATTGTTCCCCCAAAACTGTGGAAGTGAGTCTCACTGCTCATGTCGGACACCATGATCCATCATGGACGATCGATTCCGGCTGCACTCGCCACGTC
ACGTCCAACAGAGAATGGTTTGTGACCCTAAAACCGACCGCGGGTAAGTCCATCACGGTGGGGGGCAATCACCAGATTCCCATTGCAGGAACAGGTGACG
TGAAGCTATCCATCAAAGATACGAAGGGAAGAGACAGAGTCATTACCCTGATCAACGTGCTGTACGCACCTGACCTCAAGTTTAACTTGCTCTCAGTTCG
TCAAGCTGTCGAAACGGACTACAAGATCAATTTCCCGAACGCCAAGAAATGCGTCCTGTTCTACGACCGTGGAACCAAGTTCGAAGCCAAGACTGGCAAT
GGCACTCGCCTCTACCAATTCGAAGCTCGCCCGGTGAACACCGACCACGTAGCCCATGTGGCCAAATCTGGTACGTCCGATAATATTTTACTCTGGCACA
AACGAATGGGCCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCAGACGTTGTCACAGACATGGGGATGTCGAAATTCGACTCAAGCAAAGACTA
CTTTTGCTCCTCATGCACATACGCTAAAGCACATCGTAACCCATTCAATAAACGTACTGTTGAAAGGGCAAAATTCCCTCTTGAAAAGGTTCACACAGAT
ATGGCTGGACCCCTTCCTGTGCCAACACTATCAGGATGTCAATATTTCTTGACCTTTATTGATGACTACTCGCGCTATATGTTTATCTACGTTATCAGGC
GCAAGTCAGACCTTTATGGCTGCTACGAGGACTTCAGAAAGAAAGCACAGAACATGTTTCGCGCTGATGTGGGTCACTTAGCATACGATGCTAATATGCA
CGATGAAGAAATCCGGAACCTCCAAAGTGACAACGCTCGTGAATATGAAAAACTCGGCAGAATTATCTTCGAAAAATATAACACCCACGCACAGTTCACT
AATGCGTACACACCACAACAGAATGGCGTGGCAGAGAGGCGTATGCGCACACTCCTTGAAAGAACGCGAGCTTTTCTAATTGACGGAGATCTTGATCAAC
TCCTTTGGGGCGAATGCATCACCCACGTCGCTGATCTCCTCAACATGACCCCGAGCTCGGTCACAAACAACGTTACTCCCCATGAAAAATGGTTCAAAAA
GAAACCATCAGCACACTACATTAAGGTTTTTGGCTGCACGGCATACGCTCACGTCCCAGAACTATACCGCAACAAACTCGAAAAACGGGCTAGAAAATGC
ATGTATCTCGGAATTCCATCCAACAAGAAGGGCTACAGGCTCTTAGATACGACAGAGAATCGCATCATTTACAGTCGTGATGTTACCTTCCGCGAACATG
AATTCCCCACGCTGGATTTTCTCGATCTACAGAAATCAACAGACATACTTAGCCCTAAAACAGGCACTACAGTACCAGCACCCATTCAATTGCCCTCACT
GTCAGCAATGCGAAAACGCAATGCTAATGCACTTGCTGCTGAAGATACAGAACCAGCACCTAAGAAAGCAAAATCTCTCTTAGAATGCAGATGTACTGAT
CCAGTAACAACCTTGCTCAATGGTACCCTCGATCTAGAGGAACGCGAAACAAGTCGCAACGCCCTCCACACACTACTTGCTATCAGGCATATATCGGAGC
CAAAGACCTACAAGGCAGCCATGCAGCTGCCAGAAGCTCCTCACTGGAAAATAGCCGCACGATCTGAGTACAAGTCTCTCATGGACAATAAAACGTGGAT
ACTGACCAAGTTGCCCAATGGCAGGCGTGCATTGCAATGCAGGTGGGTATTTGTCGTCAAATACAAAGGCGACGGCACAATAGATCGCTACAAAGCTCGC
CTAGTTATTAAGGGTTTCCTCCAAAGATATGGAATTGACTATGATGAGATTTTCTCCCCTGTCATCCGCATGGAAGTCCTACGACTGATACTTACCATCG
CTGCTTTATTGAATATGGAAATCCATCAGATGGACGTCAAAACCGCATTCTTAAATGGGCATCTAGATGAGGAAATATACATGGAACAACCTGAAGGATT
CTTTTGCCGAGGTAAAGAACACCTCGTCTGCAAACTGATGAAGAGTCTATATGGACTCAAACAAGCCCCTCGAGTCTGGTACTTGACACTGTGTGACTAC
TTAGCTACGATGAAGTTTCGCAAACTTACAAAAGACCAATGCGTCTTTGTCGGTGAAATTGACGGAAAAACATGTTACATTCTTGTCTACGTCGATGACC
TTCTCATCATTGCACCTACAGTCGACATTGTCACATATATCAAGGACGCACTGAAACAGCGCTTCAAAATGTCCGATCTGGGCGAAGCCCAATACCTCTT
AGGGTGGTCCATTGTACGCGATCGAAAAAATCGCTCCATCTTCATACACCAAGAAAAATACGCTACCAAAGTCCTGGACCGCTTCTCCCATCTAAACTCA
TATCCAGTGGAAACACCCACTGATCTGAGTATCAAACTCTCTCTAGATATGTGCCCACAAACTCCTTTGGAACACGATGAGATGAAGGCGATCCCGTACA
GAGAGGCAGTCGGTAGCTTCATGTACCTGATGATGGGAACGAGACCAGACCTAGCCTATTTTCTACGAGAGGTCAGTCAATTTCTGGCTAATCCAGGGAA
ACAACACTGGAATGCGGTTAAGAGAGGCCTTAGATACCTAAATGGTACACGTAACCTCGGCATTACCCTAGGAGGAAAAGAAAACCTACAGCAATATAAC
ACAAAGCACTACCTCGCAGCCTTTGCAGATGCAGACTATGCTAACTGCGCCGACACACGTCGATCTGTAGGAGGATATATTACCTACATGTGTGGCAGTC
CAATCTCATGGCAGTCTAGAAAACACCACACAGTCGTGCTATCCACAACAGAAGCAGAATACATTGCACTATGCCACTGCATGCAGGAAGTCATCTTCTT
AAAACTCCTACTGATAGAGCTAAACCACAGTAGCCCACATGCCATCACTCTCTACGAGGACAACCAGAGCTGTATTAAACTCTCATATAACCCAGAACTT
CATGGTAGAAGCAAACATATACATATTCGCTACTGCTTCGTACAAGAAAAGGTAGAGCGAAAAGAATTCGAGATAAAATACTGTAACACAAAGGAAATGG
TGGCAGATATATTCACCAAGTCACTCGCAAAGCCGACTTTTCT