Description :
From Genome Similarity Track
Location :
Scaffold_697:5679- 6786
Sequence
1107 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTTCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCC
TCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGA
GACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTT
CGTCATATCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTC
GTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACTTCGTCGAAGTCGACGCGGTCGGATGCATCTACCGAAAGACGGACCTGCGGCCGA
TCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTCACCGCATGTTCTCCAA
TCTTCTCTCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATACAGCCACACCTGCGATCCCAC
TTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCATTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGTCGGTAG
TATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGCGCTGCATACTGGGATGGCCGCTTCCAGGATGGATTTGGGATCCCACC
CATGTACCAAGTAAAATGGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGCAGGTCGTTCTGCGTACTCATCCCAATCCCTCTGAT
CCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTCTGCACCATGCGCTCAGCCGACCCGTTAGCTTGAGGACGATATGCCATGGTTGTTGGCTG
ACATCAT