Description :
From Genome Similarity Track
Location :
Scaffold_932:5678- 6780
Transcript NameFunction/comments
Phyag_g8762conserved hypothetical protein

Sequence
1102 bases(100 bases per row)
CGACGAGGACTGGTGAATATGGGCAATACATGCTTCATGAGTTCGGTGCTGCAGGCTCTGGCGCACAACcccatgctgcagcactacTTTTTCGTGGCGA
GGAGTCATGATACGACGATATGTCAACAGCAAAGACAAcggttgctgcagaacagAGAGCAACAGATGAAAGCCGAcaaggagatggagcggGGCGAGGA
TGATGAGAAAGCGCAGGACGACACGAAACGTGGTCCTGATCCTGCGATCACTGTTTGCTTGGGCTGCGAGCTAGCAGCGTTCATGGGTTTGCTGGTGCCT
TCTTCTACAGATCTGCCGCAGAAAACGCTGACGACATCGCCTATTGCGCCGCAAGGGATCTTGGAGGCGATGTGGAACGCGTTCCCGTCTTTTATCGGAA
CGGCACAGCATGACGCACACGAACTACTGATAGCGCTGCTGGGCGGACTACATTCTCACACGCATCCCCGGGTGTTTGTGCATGGCGGCGCTTCTCCGCG
TTTTACTCCACGTGGACACAGTTTGTGCGATTGTGCTGTCCATCAGCACTTCTCTGGTGTGTTGCGGTCGGAACTCGCGTGTGGAGGTTGCGGGGAGGCC
TCCCACAAGTTCGACCCGTTTCTGGATGTTTCGTTATCGCTGGATGATGGAGATACCAACAATCTCAAATACGAAAAATGTGAagacaaggaggaggacg
cacCATCCGCAATAACTCTCGAGTCGTTGCTGCGCCAGTttgcagttgaagaagaactACGCGGCTCGAACCAAGTGTATTGTATAAAGTGCTCCAAGTA
CCAGACCTACTACAAGAGTCTGAATTTGCACACTTTGCCGAACGTCCTGGTGTTCCACATTCGCCGTCTCGATTTCTACCGCCAGCAGAAACTGATGCAA
AAGGTGGAATTTCCGTTGATGGGACTCAACATGAGACCGTTTACGTCTGCGGGGATCGACGAAGCCAGCGATCGTAAGAAAGGAGAGAACGCCAAGAGTG
TCGTTCAAGGAAGTGATCAAAACGAATACCTGTACGACCTCGTTGCAGTCGTGAATCACCACGGTGAGTCTGTAAACGGCGGCCACTACACTTCGTACGT
GC