Description :
From Genome Similarity Track
Location :
Scaffold_19:567672- 570954
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007529Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
3282 bases(100 bases per row)
GCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTCGTAGTCCTTTCAACGACCACGTCAAGAGTCTGCATAG
GCCGCTTGTGTAGCGTGCGCAGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGGATTGAGACGCCGATGGGCTCGATGCCTGGAGAAAC
CGTGGAGCTGACGAATGAGCATTTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGGTCATCGGTGAGGCGGCTGTGATCAGC
TTGCTGAAATCAGCGTCACCGGTTGAGCAGAGGAACGCGGCTACGAGCTTCATGCATCACGAGATCATGAACTCTCATCGACAGTCTGCAACTCCTGTCA
CGACGATGAGAGTAGCACCTCTGAAGCTCGATGTATCTCCGTACCGTAGCGGAGAGAACGAGCCTCTAGCGAGATGGTTCGTTGAGTTGGATGCAGCGAT
CACTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTTGCAATGTCAAAACTTGCGGGTCGAGCGAAAAGTTGGGCGTATGGGAAGCGATTGGCG
GAGCCACATGCTTCTACAACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCGCAGAGCGAATTTCGGGCTCGCGCAGAGTTTTTAAA
GCTTCGTCAGGGTAAATACGACCTACACTCGTACGCACAACGAGCTCGCTACTTGGTATCGAGCATCGTGGACGAGCCGATTGACATCCCAACGCAAGTC
GTGACGTTCATGACAGGTCTGAACGATGGTCCGATTCGGAACCAGCTGTTCCGTGAGTACCCGAAGACCCTGGAAGGAGCCATCAGCCGTGCGATGCAAG
AAGAATTCAGCATCAAGCAAGCCAAATTCCAAGGTTTTCCGGCAAGACCACCAAGGCAACCAAACGTTGTTCATGATGGCCCAGAGCCGATGGACATCTC
GTACATTTCCACGCCTGGAAATGAACGTCCTCGCAACGATGGAAAGTGTTTCCGTTGTGGGAAGCCGGGTCACTTCGCTCGGAACTGCAAAGTGTCTTTG
TCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGACCGTAATAATGGTCGTCGGTTCGATCGTTCCCAAAGGTCAAAAAACGGGAACGACC
AGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGAATGTTGTGGAAACACAGGACTCTGGCCCCAATGTGCATGATGCACATGCAGTTTCC
ACGAGTGAGAAGAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCTCTACGAGCTTTGGTTGACACTGGTG
CGTCGAACAACTTTGTTCGAAATGAAGTGATTGCCAGGCACAACATCTCTGTGCCTGTTGCAAATGAAGAGAAGACGATGATTGTTCGGTTGGCCAACGG
GTCAACTGTGAAGATGCCAAAGCGAGTCGTTCGCTTGGCAATGAAGTGTGAAGATTTCCGAGGCGAGGACGAGTTCATCCTTCTCGACCTCGATGACAAG
TTTGACATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACATGAAGATCTCCGTTGACAAGTCATGCAGCGCTGACT
TGAGCAGCATGACAACGGATGAAGTGGTATGGGTTTATACATCTGTGGAAGAAATCTCAGATGGCCCTTGTGATATTGCGGTGTGCGATGGCCCCCCATG
TTCACAAGTGGCACCCATTTTGAAGAAGACAAACGGAGGTGGAGCAGTCAGGCGCCAGAAAAAGACTGTCTCCTTTGCCATCGACGACAAAGTTGCGTGC
GATGGTAGTATGAAGAATGACGGGAAGATAGGCAGAGACCCGCCCCAAGACAAGAAAAAGAAGACCAGCAAGAAGAGTGTTTCATCAAGAGTTTCAAGTG
CCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCAAGAGTCACTTCGAGCGAATTTGTGAATATCGCGGTCTGCAAGGAAGAAGGTGA
CGTGAATGTAATCCGTCACGTACAAGTGGAAAATCCTCCAAGTTCTGTCCAAGAATTGATTTCCTTGCCATCGATGAGCAAGAAGACGCTGAAGCGTAGC
CTAGCGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGCTGTTGGCGATGCAGAGGACATCAGCACAGTATCAGCAATGGAAGCTGAAGTGCTTGATG
AGAAGACACGGAAGGAAAGGTTCGAGAAGCAGTCATGGGACGCTCTCAAAACCAACCCCGTGTATGCACTTGCCAGGGAATTTGAAGACATTTTCCCAGA
CAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCACGAAGTACTGCATCACAAGACAGTGGCCGTTGCCA
AAGGAACAAGTCGATGCGATTGATGAGTTCTTTGCGCAACGTGCAAAGGCTGGCCATGTGCGAGAGAGTAAGTCTCCGCATTGCAGCCCCACTTTCTGTG
TGAAGAAAGCAACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACCATACCTGCTCAAACTCCGGTTCCACGCAAGGACATGAT
CCTTGATGGAATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCGCGAAGATGATGTCCCACTAACTGCA
GTGAGTACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCTCCTGCGACCTTCAATCGAATGGTCACGAACGTTCTTC
GTCCTTTACGAACATTTGCACCGAGTTACTTTGACGATATCTTCGTTCATAGTAAGGCCACGAATGGGAGATCTGATGTTGATGTTCATCTTGATCATCT
TCGTCAAGTTTTCCAGGTCATGCGTGAAAACAAACTGTACGCAAACTTGAAGAAGTGTATGTTCTTCGCTCCCGAGATCCCTGTTCTCGGATGTTTTGTG
GGCAAGAACGGTGTTCGAGTTGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGTGCCTCAGAACGTAAAACAGCTACGCCAATGGTTGGGTCTGG
CCAATTACTTGCACAAGTACACGCGCAATTATGCAGCGTAGTGCACCCTCACCAGCTCTGAGAAGACGTTGAGTGGAAGTGG