Description :
From Genome Similarity Track
Location :
Scaffold_19:567637- 573900
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007529Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
6263 bases(100 bases per row)
AATTTTGCCAAGTTCCTCCCAAGTCTTCCTCTCAAGCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTCGT
AGTCCTTTCAACGACCACGTCAAGAGTCTGCATAGGCCGCTTGTGTAGCGTGCGCAGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGG
ATTGAGACGCCGATGGGCTCGATGCCTGGAGAAACCGTGGAGCTGACGAATGAGCATTTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTA
TGCGAGCGGTCATCGGTGAGGCGGCTGTGATCAGCTTGCTGAAATCAGCGTCACCGGTTGAGCAGAGGAACGCGGCTACGAGCTTCATGCATCACGAGAT
CATGAACTCTCATCGACAGTCTGCAACTCCTGTCACGACGATGAGAGTAGCACCTCTGAAGCTCGATGTATCTCCGTACCGTAGCGGAGAGAACGAGCCT
CTAGCGAGATGGTTCGTTGAGTTGGATGCAGCGATCACTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTTGCAATGTCAAAACTTGCGGGTC
GAGCGAAAAGTTGGGCGTATGGGAAGCGATTGGCGGAGCCACATGCTTCTACAACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCG
CAGAGCGAATTTCGGGCTCGCGCAGAGTTTTTAAAGCTTCGTCAGGGTAAATACGACCTACACTCGTACGCACAACGAGCTCGCTACTTGGTATCGAGCA
TCGTGGACGAGCCGATTGACATCCCAACGCAAGTCGTGACGTTCATGACAGGTCTGAACGATGGTCCGATTCGGAACCAGCTGTTCCGTGAGTACCCGAA
GACCCTGGAAGGAGCCATCAGCCGTGCGATGCAAGAAGAATTCAGCATCAAGCAAGCCAAATTCCAAGGTTTTCCGGCAAGACCACCAAGGCAACCAAAC
GTTGTTCATGATGGCCCAGAGCCGATGGACATCTCGTACATTTCCACGCCTGGAAATGAACGTCCTCGCAACGATGGAAAGTGTTTCCGTTGTGGGAAGC
CGGGTCACTTCGCTCGGAACTGCAAAGTGTCTTTGTCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGACCGTAATAATGGTCGTCGGTT
CGATCGTTCCCAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGAATGTTGTGGAAACACAGGACT
CTGGCCCCAATGTGCATGATGCACATGCAGTTTCCACGAGTGAGAAGAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTAT
TGCAACGCCTCTACGAGCTTTGGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATTGCCAGGCACAACATCTCTGTGCCTGTTGCAAAT
GAAGAGAAGACGATGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTCGTTCGCTTGGCAATGAAGTGTGAAGATTTCCGAGGCG
AGGACGAGTTCATCCTTCTCGACCTCGATGACAAGTTTGACATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACAT
GAAGATCTCCGTTGACAAGTCATGCAGCGCTGACTTGAGCAGCATGACAACGGATGAAGTGGTATGGGTTTATACATCTGTGGAAGAAATCTCAGATGGC
CCTTGTGATATTGCGGTGTGCGATGGCCCCCCATGTTCACAAGTGGCACCCATTTTGAAGAAGACAAACGGAGGTGGAGCAGTCAGGCGCCAGAAAAAGA
CTGTCTCCTTTGCCATCGACGACAAAGTTGCGTGCGATGGTAGTATGAAGAATGACGGGAAGATAGGCAGAGACCCGCCCCAAGACAAGAAAAAGAAGAC
CAGCAAGAAGAGTGTTTCATCAAGAGTTTCAAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCAAGAGTCACTTCGAGCGAA
TTTGTGAATATCGCGGTCTGCAAGGAAGAAGGTGACGTGAATGTAATCCGTCACGTACAAGTGGAAAATCCTCCAAGTTCTGTCCAAGAATTGATTTCCT
TGCCATCGATGAGCAAGAAGACGCTGAAGCGTAGCCTAGCGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGCTGTTGGCGATGCAGAGGACATCAG
CACAGTATCAGCAATGGAAGCTGAAGTGCTTGATGAGAAGACACGGAAGGAAAGGTTCGAGAAGCAGTCATGGGACGCTCTCAAAACCAACCCCGTGTAT
GCACTTGCCAGGGAATTTGAAGACATTTTCCCAGACAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCA
CGAAGTACTGCATCACAAGACAGTGGCCGTTGCCAAAGGAACAAGTCGATGCGATTGATGAGTTCTTTGCGCAACGTGCAAAGGCTGGCCATGTGCGAGA
GAGTAAGTCTCCGCATTGCAGCCCCACTTTCTGTGTGAAGAAAGCAACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACCATA
CCTGCTCAAACTCCGGTTCCACGCAAGGACATGATCCTTGATGGAATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGA
TTCGAATGCGCGAAGATGATGTCCCACTAACTGCAGTGAGTACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCTCC
TGCGACCTTCAATCGAATGGTCACGAACGTTCTTCGTCCTTTACGAACATTTGCACCGAGTTACTTTGACGATATCTTCGTTCATAGTAAGGCCACGAAT
GGGAGATCTGATGTTGATGTTCATCTTGATCATCTTCGTCAAGTTTTCCAGGTCATGCGTGAAAACAAACTGTACGCAAACTTGAAGAAGTGTATGTTCT
TCGCTCCCGAGATCCCTGTTCTCGGATGTTTTGTGGGCAAGAACGGTGTTCGAGTTGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGTGCCTCA
GAACGTAAAACAGCTACGCCAATGGTTGGGTCTGGCCAATTACTTGCACAAGTACACGCGCAATTATGCAGCGTAGTGCACCCTCACCAGCTCTGAGAAG
ACGTTGAGTGGAAGTGGTCGAAAGACCATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCG