Description :
From Genome Similarity Track
Location :
Scaffold_6:567637- 569028
Transcript NameFunction/comments
g973.t1hypothetical protein

Sequence
1391 bases(100 bases per row)
TCGCATCGTCTTGCACAGCCAGCTGGGTCCTTGAGGGTCCACCGACGATTCTTCAGATCACGTCTAGCGTAGTTGTCGATGTTTTGGAATGGCCTCAGTT
TCACTGTGTGGTATGGGCAAAGGTTGACAGCGTCGCAGGAGTGGGTAATTCTACAAAACAATTCTTTGTACTGTTTCCCGGATCTGAAGTCCGAAAACTT
GAAGACAGTCGATGCGGGGACCAACCCGCACGGAAATAGGGTCAAGTGTATTGATGTGTTGGTCACTTAGCCAAATAAAAAGTGAGAGACGTGGTGAGAT
CATGAGTCTGGTGGTCACCAGCTCGTTCACACTAACACGTTCTCCCAGAGATTTGGGCTGGTGTAAGGAAAAGCCACCTGCTCACGACACAGCCCTGACA
ATGTACGTCATGTAGTTGACCATACCAGATCTTTATACTACTCGGTCCGGCATTTGTTGCCTTTCCGAGACATACAGAGCTGCACCCTTTGTCCACGTCT
TACAGCTGTCAGATACATTTGGGTCCACTTGTGACAACACCGAGACATCACTCCTCGACTAACTTCTCGCCAGTCGCCAGAACTGGATATCCTTGGATAT
GCCTTGCCCAGAGGCCACTGCAGCTGCGGCAACCAAGCTGAATACCTCGTGCTCACTACATGCTGTCATCCAAGGATGTTAGTGCGCAGGCATACTATAT
ACTTCTTCGAGAACGGCCTCTATATGGTAAATCGAGGCAAATTACCCGACTAAAAGTAATGAGACATAGAATGGGGTATTTTATAGTTGAACATCTGATT
GGGAGCTAAATGATGAGTGTCCACCTGCTAAAGGACCATGGATAGAGAAAGTAGAAGCTGTATATATGGCTCGTCCTAGGATATCCCCTTTCGGCGAAGT
GACTCTGGCTACATTCGCCGGAAAATACGAGTTGGTAGATAGTATCTGTTCTACTAAAGTGAGCTCCGCACGCTGGAAAAAAATTGATTCAAACGGGTAC
ATCAAACTTCGTTGTACTCCTCATGTCGTGCACGGCTCCTCCTTGGACAGCTGAGAACTCGACTAACCCAAATTTGTGCTTTGCCGAAATCTTTTAACAT
ACGCAGTGGCGGTCTCTATCAGACCCACCCGAGTCCGATGAGGAGTGTTTTAGTTGTTCGCGAGCGAGCAAGAAAAAACTTTGAATAGCGGGATAAGAGA
GGAACCACAATTAATTATGTCACGGCAAAGAAATAATTAGTTTTTAAAAGACTTTCGACCACATGAAGCAGCGACCTTTTTCCAGCATCAGAATATATTG
TTAGTAGTCGCACAAGTACAATCAACTAACCCTGAGGGTAAGAATAATTCGATCGGAACCACGTGGGCAACAAAGGACAATTACACTGCAG