Description :
From Genome Similarity Track
Location :
scaffold_161:5676- 10775
Transcript NameFunction/comments
g7398.t1hypothetical protein
g7399.t1hypothetical protein

Sequence
5099 bases(100 bases per row)
GAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCTGTCGCTCCATTGATGGAACGAATGCGCGTAGCTCTTCATGGTGTCAACCAACA
CGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGTGGGTGATCCGCAGGCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAACCG
CGCTGTAAAGCGCGGACCCCGATCCGACACGATGTCGAGTGGTGTCTAAACACCATGTCAACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTG
GTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCAT
TGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAGGCACGA
ACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCAT
CGTGGTACTCGTACGTGATCTTGATCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATT
GTGTACACGATAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAAGTGTGGAGAAGTACTCCAACAACTGCTTCGCA
TCCGCATCATGCGCGTGTGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGAATAGTCGGCCTCTTGCACCGTATAACCTGGTCGACGCGAAAGCACG
TCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCG
ACTTGACCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGC
AAGGAGTTCCTTGTCATGTACCGGGTAATTACGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGC
ATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGACACCGCCAAGATCGGCGCCTCAGTCAAGCCCT
GCTTGACCGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTT
GCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCT
GGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCT
TTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATA
GCTCGGTGCGAAGTCGCGCACCGGGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCC
CAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGA
TAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTATACGCATGAACGAT
GCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGTTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAG
TCGTTGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGT
CCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTC
GTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCATAGATGAGCTGCTTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCC
GAGAGGATGCAGATCTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGTTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTT
CAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTGCGCGTCAAGACACTCAATGTCTCGATGGTCGTCTCCAAATCCTGTGTCTGCCCGGCAGACACT
GCATGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGTGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTC
CAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTGCACGCGAGCTCGCAAGCATTTC
CGGTGCGGGACGTTTGCAACCGTCTGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACCTCGACGCCTAACGGCGGAGTGTCTTTCG
ACAAATTGTGTGTCGACATTATCTGTCGACACGACCGCGTCGCTCTGGACGCTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGGTT
CACATCTTCTTCCAACGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGT
GCATGTGCTGCTCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCC
GTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTAC
GCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGG
AGGCTCTGCAGTCGAACAAAGTTGTTTGACGCACCACAGTCCACTAGAGCACGAAGAGACCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCG
GCTTGTCATCTTGCTTCTTGCAGTGATATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGC
AGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTTATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGC
ACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTC
CATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGT
ATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCT
TTGTCGCCTCGTCGATCGGGTTGGTCGCGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAA
GAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTGAAGCACGTAGGGTTCGTG
AGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATCACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCTAGCCGCAATGG
CAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGA
TGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTGGCTCCGTCGGTGATAGCGTTCGCAACATC
GTTGCTACCGCTGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAAGATGCGTTG
CAGACGTGTTTGGGCTACCCACGGACATGTAACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACG
GACTACAAGGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTAACTT
AAGTTCAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGG
GTTTCCTCCTGAAACTGATATTTCTAATGAGAGGTTCTGCCATTAGATGGCTGACAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGATGTTA
CTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACAAAGGTAGGAGGTG