Description :
From Genome Similarity Track
Location :
scaffold_116:56747- 57992
Transcript NameFunction/comments
Pl_109421hypothetical protein PHYSODRAFT_552999

Sequence
1245 bases(100 bases per row)
CAAGCGCACCAAAGCTCGCCGCGCACCCACTGCTACGTCCGAAATGGACGATTCCAGCGACGATGTGTCCGAGACGGAGAGCGCCGAGTCCAGTGCGTCT
GCGCCGTATTTGCGTCGCGAACAATCGTGTCCTGCGCCTCGCAAGGCGCGTCTGAACACGCAGCCTGAGAGCGAGAGCGATGCCGAGAACACGCGCCCGG
CGCTCAAAGCTGTCTACTCGTTCGCACTCAACACGTCGTCCAAGCTCTTTCTAGTCAAACCTCGACACAATAAGTCTGGGGACTTTACGCCCAGGAAGCC
TCACTCTCGCAGCGTCGATGCAGTGGCGGAGAACGTGCACACCAAGTCGGCGGGTGCGCGCGTGGCCACACCCTTCGGTCTCGGTAAAATTATAGTGATC
AGAGACGATGATGGCGTTGCGGCCATTGAACTGCAGGCTTCTGGACTGCTGTTCCTCAATGCTATTGAGATGGAAAAAATGCAGGTTGTCCCTGCACTTG
TAGGTGAGCGCGTGTACACGCCGTCGGGCTCTGGTCGAGTGTTGAAGTATGAGATGCAGGAGCAGCTGTATACGCTGCGGTTAAGAGCAGGTGGTGGTCT
CGGTGAGTACGAACTTCAGCTTCGCCCTGCAGATGTCCGAGTGACAGGCACGAAGAATGTGGAGCAGCGACGTCCACGAGGAATGTCCGAAGGCAGTGTG
GACTGGGACTCGAGACGTCGTTCTAGGTCGAGTGCTGGCTCGACTGCAGGTGCTGCAGGTTTGACACTGTTGAAGACCATTGCAACGACGTCATACACGT
TCGTAGCGAGTAAATATCACCAGGGACAACCTGTGATCACCAAGTTTGGCGCCGGGCATATTCTTTCAGTAGATCCACAGCATGGCTCGGCGCAGATACA
GCTAGTATGGGGTGCCATTGCGTATCTCAATGCTGACATGATTGATTTCTACCCCAAGGCACTAGAGGGAGCTGATGTGTCAACCAAGTTTGGATCAGGT
GTGGTAATTGGACTACGACCGAAGGATGCTATCTACACGGTGCGCCTGCATGACATCCAACCTGCTGGAAAATCTGATGTGGTATTTGTGCATGAGTCGG
ACCTGCACCGAAGCCGGAAAATCGCAGTCACGGCAGCGAATGTCCGGGACAGACTCAAGGCGATGGCGCAGCGGCGTTTCGGTGAACGTATTGTAGTGGC
AACCCAGCAACATGACGAAGAACCGAATTCCGCAGGCATCTAAGC