Description :
From Genome Similarity Track
Location :
Scaffold_224:56741- 61690
Transcript NameFunction/comments
g13576.t1ETI41425.1 hypothetical protein F443_13328 [Phytophthora parasitica P1569
g13577.t1hypothetical protein

Sequence
4949 bases(100 bases per row)
AATGCCGCGTCTGCTTGCTTTCTGGATTAACACCAAGTTCAGTTTTTCCGCAACACAGTTCTTTCGGATGGACTAGCAACAGCCGTTAAGATTTCGACCC
AGTTTCAGCGTAGCGACGACAAGCTTGCTGCTCTAAGAGAGTCCTGCGATGGGCCGAAGTCAACACCAAGCACCCGGTCTCGCCCAGTTGAGCATGCCAA
AAATGCACGCCGCACACCCGGGTCTAACCGAATTCCTCCGGAAATTTACGCCACGTTGCCACGTGGGGAAGACGGAAAGACTCTATGCCTCCAGTACCTG
TCCAAGATCGGATGCCACTTCTCAAATTGTTCGTATGGCCATTTCCGCCCGACGTCACTTTCAGCGGAAGCCAAAACGGCTGTCATGGAACGATGGGGTG
GTCTTGGCACTTCGTTTAGCGACTTATGACTAGCGCCAACTCTCCAACTCAGCAAGAACGGCATGAGGAGAAAGAAACTATGGGCCACAACAGATTCATG
TCAACTCTGCATCGATTTCATGAGCTAAACCAAGCGACAATCTTTGAAAATCTCCAGAATAACGAGTTCGGGCTTCAGCCACCACCAGAGCGGCCGGACT
TGGTCGCCGATATCGACAAGGATCAGGTCCGGTTCTGGTCTGATCTCGCTGAGCAAAGCAAGTGGAGTCTACCACAGGTCGTTCGTCTTCTCCGGGGTCA
AACAGAAGCCGATCCTCGACCAAACAAAGATCTCTACGAAATACCGATGCCCGTTGACCCTTCTCTTAAGCCCACTGTGCTCGAGTGGAACAAAATCGTT
AGAGAAGGTGTACGGCCTCAGTGGTCAACCGACTTACCAGCAAAGCAGACCACACGCCCTCAAAACCATGCCGGACTTCAGGCTATGGCACCGCAAATAC
TTCGCCATTTGCGTCGCGGTCAATTTGAAGGACGCTACCTGATCGTCGAGTCACGGTTGCTCGAACAATGGCCGGACGTATTCATCAGTCCACTCGGAGC
TGTCGAAAAATCTGGCTCACCCGCAGCTGATATTCGGCTAATTAACGACTATTCGATCCCTGATGGGTACGCGGTCAACGACTACACAGACCGAGAAAAC
TTTCCTTCGATCTTGTACACCCCCCCTCGAGATATCGCCACTCGAATCCATCATCTCACCACTTCTCACATCGGAAGGTGTGTGTTAATGATGCTCGGGG
ATGTTTCGGGCACATCCCAATTCATTCGGAACATGTTCACATGTTCGCTTTCGTTTTCGAAAACTACCTCGTCATCGACCTTTCCTGCGGGTTCGGCTGG
TGCGGGTCACCGGCATTTTACTCGATCGCCGGCCCGATCATTAACGCTCTGTACGAACACGGCAACAAGTTGACTCGCCAATTCTCCGGCAATGTGTGGT
GCGACGACCACACGTGCATCGAGATCGACAAAGGGACAGTCTGCTTCGACGCTAACCTCTCACTCCGGCGTGCAATGGCCACCGTCTTGGGACCCACAGC
GATCAACGAGCAGAAATGTACAGCATGGTCTACTAAATGCAAGGCATTGGGGCTTCTGTGGAACACTACAACGGCGACAGTATCAATTCCAACGGAAACA
CTCGTCAAGGCTCTCAATCGGGTTGAGCAGTTGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCACACATTCAG
GTGACCACCACAGGGTGGTCCACATTCATAACAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTC
TGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTC
GTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTG
TAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGG
GGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATCTTGCGCGTGCAGACTGCCCCACCTGTCGGAACCAG
AGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCT
GGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGC
TACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGT
TCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGA
GCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAA
AGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGA
CCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGGGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACAC
CCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGA
TCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTG
GGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACATGCTGCAATG
AAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTC
TTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATT
GGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATC
GTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCT
TCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGC
GGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTAGGAAGAAGATGTGAACCGAATCAGCAGGGCCTGATTCAATCGGATTCGAGA
GGGTCTCGAAGCGTCCAGAGCGACGCGGTCGTGTCGACAGATAATGTCGACACACAATTTCACACAATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGA
GGTAAAGAAGGCGCGTCGGCTCTGGGAGCCAACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAGATGCTTGCGAGCTCGCGTGCAGCCG
GACTGCACGACGAAGCGGTGCGCGATCAAGTCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGG
GCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGAGAACGGCACAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTA
CAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACAAGTATTGGTCTCCAATACAAGAAGATGA
GGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCCCGCGACCTGCACGATGGAGATCTGCATCC
TCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGATGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTT
CGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGTGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCG
CAGGACAAGGGTATTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGACGCGTGAGCAAGTCAAGGCAATCG
ACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCTGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTG
GCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATGCCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGT
ACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCA