Description :
From Genome Similarity Track
Location :
Scaffold_125:56738- 58683
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_125-snap-gene-0.30UPF0171 family protein

Sequence
1945 bases(100 bases per row)
GGCATCGCGCTCGTCGTGGACGACATtcACAAGGGCTGCAACCTCGCCTTCCGCTACCCTGCGCCACCGGCGTCACTCGACCATGTCTCCAGCTTCCACA
AGCTcaGCGCGCCCCTCATCGCCAAGCTCTTCCGCCCCAAAAACGCGCTGTGTAACGAGAGCTTTGAGCTCGTGATCGACGACTTGCGCTTCATCAGCCA
TCCCGTGCTCGTGCCGAAACGCGCCGCGTCGACTTCAGCATCGGTGAATGGACTATGCTCTAATACACAGACAGCAGCGGCtgCAAACGCTCCGGTCGGC
TCAGGGTCGTCaCTGGTGGTGCCTCCTCCGTCTGGGTCTTCTGGCGTGGCGCAGGGGCTACTCCGTCGAGACAATGACACGACCATGTTCAACATCATCT
TCGCGCTGGAtGAGCATCGCCACCAGCCATTTCAGCAGCGCCAGCAGCTAGTGCCGGCGGAAGGAAGTGGCGACAGTTCCAGCGACGGCAGCACGTCCAC
CGAAGACGATGACCAAGGTGGGTCCACCCCAAGTCGACCAGGGGAGCCCTCTGCCCAGCTTCAGCAGCACAAGCAACGCATCGCCGCGTTCCGAACCATT
GCTGCACAGCTAGCAAACGGTCTTCTTCACGAAGAGCTGCGCGCTGGTTTCGTCACCCGCGAGGTTCGAGAGTTGCTGCACATCCGAGACGAGCTCGTTC
AGAACGAACGCATGCTGATGGCGTCCACTGGATCAGGAAACGGAACCAGTAGCTCGtcAAGTGCTGCAGGCAGTGTCAGTGGAAGTgCCGGCACGGGAGG
TGGAAGCACTGCACCGAAGGATTCGTCTGAGAATTCCACCCAAGGAACTCTCGAAGTCGATCCACAGACCCTGATCGACGTGGCCTTGGGCAAAAGCGTT
CTTGCAAACGATCTCAAGAGCGTTTTCCACGGTCTGGAAGAAACGGGCACTGCCCATGTGGTCATCAACCATTGGGTCAAGTTGTCATTAACGTTGACAG
ACGCAGTCTCACTCAAGATGCAGAGCATGCGTCCGTATCAGACCCTGCTGCTTCTCGCTGACGAAGAGTCAATCGTAAGCGCACTTCCGTCAGACCACTC
GTATCAGCTGCGGGTTCTAATCAACGCTGCGAGTCCACTGAAGAGCTTTCAGGACTTGGCATTGGAGACCTCCATTCCTATTCACCAACTCTTCCGCTTG
GCGGCGCATATGGTGTACTGGGGcTACGGCCGGGTGATTGACACCATAACCATGCACAATATCTATCAGGTACACCCGAGAAAGTCACTGCGCTCGACCT
CCGCaTTCGCCCTCGAGTTCAAGCGGAAGTTTCCACCGCACGAACTCTGTGAAGTCCTCTCGAGTTTCAACGGTGCAAGGCGCCTCGGTGATTATGTCAA
AAATCTCACCAACAGCAAGAAGGTGGAGTACATTCACATCCTGGTGAGTTGGCCTGAGCAGACAGCGAAGGCATAGGCACTGACTGGCTCTGTAGATATG
GCTGTTGCAGCGAGACTTCATCATCCAGCTGCATCGATATGTGTACTTCATGATTCCTTCGGATCAAGAGCCTCAAGCTGAtcAAGACCCAACGAGCAGT
GTCGAGAACCGCTCCTTGATGGCAAATAGCCATGCCAGTTCAATCAACAGACGCGTCGACCGACGATCCCTGACCCAGCAACAATCGCTCATCGAGAAAG
CAATGCTCGCGAAGTCGGTCCcTCCAGCTAACACCACCAATGTCGGCTTCTCGGATCGTGAACGTGCCTACTTGGATCGCATTGCAACGACGAATCCAGT
GTTTACATTGTTTAAGAGATTATGCGTCtATTTTCACGGCCAGTATCACCTCGAAGAGATCATGTGGCGAGAGAACGTATCCCGGAGCGAGCTACGGACG
GTGCTCAGCACTTACCAGGACATTATCGTTTGCTGCCTTCATGAA