Description :
From Genome Similarity Track
Location :
scaffold_42:567302- 572137
Transcript NameFunction/comments
g11354.t1 hypothetical protein PHYSODRAFT_329696
g11355.t1 conserved hypothetical protein
g11356.t1hypothetical protein
g11357.t1 conserved hypothetical protein

Sequence
4835 bases(100 bases per row)
CCTCGCGCTCCGCTGTCGGGGCGTTTGACTCGGACGGTGAGAAGAAGTCATACCCTTGACGCTCCGGCATTGTTGCAGCTGATTCCGTGCTTGCTGGAGA
GATGAAACTCGAATCCACCCGACGCTCTTGACCTCCTTCTCCTTTGTTTCGTGCATCCCCACCCAGCCAGCGCTGAACTCGATCCATCGTGAGCAGCTTG
ACGAAGGATTCCTCACTGAGGCTGGCCGTTAGGCATCGCACCCTACCCGATATCACTCGGCGGTGTTGCTCTCGTTCTTCGGCACTGAGCTCAAACCATA
AACGCCCTCCCTCCCGTCGACGATCCTCATCAAACTTCTGCACAAACAGCACAAAGTTGCGGATCTGGTTCTTCATGCGATTGACCGCCGTGGAGGAGCG
AACGAATGAGCTCCGCCGTGAAAACAGAGCGTATACCTTGGCGTGAAGCGTCCCCGTACCTCGCTGGCAGCGCAGCGTAGGGTACTTCGCCTCCACGTCG
CTCCACGCCTGAACGAGGACGTCGACTTCGCTCCTAGTCCACGAGGTTACGTTCGACATCGGAGCTCGATCTGCGAATTCCTAACTGGCGGGTGCCTCGA
CACGGAAATTGACGGCGTGCTGCACCGTCCCAAGCGTAGGAAGTCAAGTCGGAATAAAGGTCATATTAGAGGATGGCAGCAAGCAGCGCCTCGTGCGCTT
GATACCCTTATGAACGCACCAGTCCTTCCCAATGGTTACTGATCGTTACGATCTCGACCGGGAGCAGAGTTGCCGTAGCAGCGCATGGAAGTCCTCTCTC
TCCTGCTGTCGCTCCGTGTGCATCTGCGCGAATAAATCCATGAATTGCTCCTGCTGCTTGCCTACCAGTGACTCCATGAAGGGCACGTTCTGCTGAGGGT
CTTCAGGTGGCGTGCGCTGGTGCAAGATGTCCAGTAGCATCGCTTGGTTCTGCTTGCGTTCCTCCATTCGCTCCTCTCTGAGATCGTGCATGAGCTGCTC
GAAGCGTGCGTTTTGTGCCTCGAGAAGCGACTCGACCACCTTCTCGTCTACTTGAGGCTCCTCGTCTTCATAGACAGAAGGAGGTGGCAGTGTGGCGGGG
AGAAGAACGTCCTCTGGGTCGGACACTTCATCGTCGTCATGGGACGGAGAGAGGCTGGGGGAAATGGCCGGCGAGTCCTCCGACAATGCCTCGGACGACA
CCGACGGTTTCCGCGACTTCTTCGGGGTCCGCTTCCGCTTCCGGCCTGTGATCGCCGCTAGCACCTCCTCCTTCTCGATGATGACGCCGATTTTGTGGTA
CGTCTGTCGGTCGATCTCGCAGCCCACGCGTTGGCTCGACTTGGGGCTCACCAGTTTCCGCTGGAGACGGAACCGCTCGTCGAAAGTGAGCTCGAACCAG
TCTGATCCGTCAAGAGCCTCCAGTCCGACCACGCAGCGCGTGATGAAATGGTAGGACTGGATGATACACCGTCTCTTGGCTGTGATGGACCCGACCGTCG
TCTCGCTCGATCCCCCCATCGCAACGAACTTCTGTCGAATCAACCAGTTGGGCAGCTTGACCGTCTCACTCGGTTCGTTTCCGAGGTCGAGGAACTCGTC
CACTGCGTCTTGCCACGCGTCCACGAACAGCGCCCAGTCTTGGGTGGTCCACGGCTTGGGGGCGTCCTCCACCGCCTCCTCCATCTCTGGTTCCGTGTCG
TTCTTCTTGCGCTTGGGTTTCACCACCTTTTGCTTCAAGGACCCACCCCCTTTCCCCCCACAGACGTGGTCGAGTTGGCGGAAGAGCTCGGGACTCACGA
CCGTCATGCCCTTCTCCTTCTTGTTGGTCGCCCGACGCAGCTCGTGCTGCTCGGCCGCCGGGAGTTCAAACCACGAGGGGGACCCCGTCCGCCGACTTTT
CCGGTTCGTGTCCACGATGAGGCGGTACGACATGCACAGGCGGTGGTGCTGCCGGGTGACCGACGACAAGCTCCGTTTACTGCCGCCCGAGAGAGCGCAG
AACCGCGCGTGCAGCGTGGAGCGCTCCCCCGTGGACAGAATGAGTCGGTCCTTGGGGTCGTCCACGACTTCTTCCCAGGCTTGAACCAGTTGCGACAACT
CGTCTTTGCTCCACGCCGCATTGACTCTGGCGGTCGAGCTTAGTGTCGACATGTTGCCCACTCGATTGGGCCCTTGACGAGGTGCTGGGGGCGCTCGGGG
ACGCTCTGTAGCGCTCAGGGGCGTGCAGAGGTCGGTTTCCAGCCGTCGAATTGAGATTTCGAGGACTGTCGCGCTCACTGGCTGGGGATTTGTCGAAAAC
TGGACGGAATCACTTGGTGTTTGTATGGCTTCCAAACTTTATACCCGAAATTTGCCGGAGAAGGTGGTGCAACATCGAAATTCAAGCGCTACTTTGGTTT
ACCCAATTCATGCAAACTGCAACTATACTTGCTCGGTCACTCCTTGTGCTCCTGGTCCTGGCTGCCCACGAGGCGAGGCCCACCCAATTCTCGCAGCAGC
ATCCGAGCTTGCTCGCGCTCCTGCGACCGCTCGTCCTGCAGCTGGTTGAACAGCCCCAGCATGTGCTGGCGCTGCTTCTCCACCAGCGCTTCCACGAACG
GAGCCGGTTGATCGGATTTCTGGGCCGACGCACTGCGCAGCTTGAGCGCCTCGAGGATGATCTCCATGTTGTGCTGGCGCTCTTGTCGCCGCTCCTCCTG
GAATTCCGCGAGAAGTGCCTCGAACCGCTGGGTCTGACCGTCCAGCAACCGCGACACCCACTTGGCGTCACTCACCCCCGTACGACGGCGCTTAGGAGGC
GAGCCACCGCTACTTGCAACGTCGGCAGGGTTCACCTCGCGACTAGATCTCCGCGCTCCGTTCTTTGCAGAATGAGGACGTCTAGACACCACCAGGGCCT
GTGAATTTGCTCCTCGACTTGAATTTTCACCCCTGCCATTTCGAGCAGGTGCAGCCCAGTCGGAGGTCTCATCTTCCGACTCGGACGTTCTTTCTGCAAC
CACAAAGCCACGAGGAGGGCCACCGGCATACTTTCCCTTGCCTAACTTCTTGCCTACCTTTTTCCGAGGATCCCTCGCACCTTTTGCCGTTCGTCCAAGA
AGCTCATCTAGAGTCACCGGGGCGCGCAGTGCACTGGCCACCGGCGTTGAAATCGCTCGCTGCGCCCGGTCAATCTCGCCAAGTCGCTGATACACCTCTT
TCTCAATATAACACGCGTGCTCGTGGTGGTGTCCGTGCATCTTCTGCAGTTCCATCCTCTCGTCGGGTGTCATGCCAAACCAGTTGGGGCGCTCACTCAG
CGACGCCAGCGTGCGGAGCACTCCACGCAGCGACCGGAACGCCATCATGATGGCGTGTTTCTTGGCGCCGGTTGACTGGTTGGTGCGTGGCGTTTTGTCT
CCGCACAACTCCACATACCGCTGGTGAATCAGCGAGTTCAACCGCAGGCCCTCGTTCCGCGACGCGAAAGAACCTTCATACCCGTTATCAATCAACGTCG
TCACGACCCCATGCCAGGCCGACATGAGGAGTTGTTCGTCTCGTTTCGACCACTTGGACGTCGCCTTCCCCTTGGCTTTCCCCTTTGCTTTGGGCGGGGT
GTAGTCCAGGTCACTGTCCTTGCGGCTTCTCTTGGTCGGTGCGTACTCCTCCTCCACCGACTCTTCGTCCGATTCGGACGTCGCTTCCCTCTTTGTCTCC
ACCTCAATCTGCTTAGTGTTTGTCGTCCGAACGGGGGACGACGGAGGTGACAGCGACGGTGACAACGTCGGTGGCGCCTCGTTGTTGGCCCGGAACATGG
GCAGCCCCGCCAATGCCTCGGCCGCCGCCTTCATCTCGTCGGCCATTGGGGGCGACTGCAACTGCTCCGGGGGTTCGCAGATCCGCGCAAGGTACTGGAA
CTCGTCCTGCGTCACTTCCGCGAGGTCCCCGAGGCGCCCGTTCATGCGGCGCAGGTCGTCCTGTTGCTGCGGCGGCAGCTGGAACCACGTGGGACGGCCG
GCGCGCGCGCTCTCGGCGTTGAATGCGCGCAGGAACAGGAAGGTGCGCACGAGTCGCTGGCGCTGTGCTTCCACTTCCTGGATGGCGATGGGTGCGCCGT
CCCGCGGACGCAACGCGTCGAACCGCGCGAGCACCTGCTGCAACTCGTCGTCCGTGAGTTCGTCGCGGTCGCGAGGAGCCGCTATCGCCTGCTCCCACGC
CTGCAGCAGCGCGAGCAACTCGTCTCGTCGCCACTGGACCATGTTCGTTCGACTTTGGTTTCTCTCGCCTGAATCCTAAGCTCTCGATGGTTTATTTATT
TATATGGCGAGTTGTATGAGACTTTAATTGACTTCGAAGGTACTGGCAGTTTTTAAGAGCTTGCTGTGACTTTTTGACTGGCGATGGGAGATACTGCGAG
TATCGTGCAGGTGTTCGACGAGGGCGAAGTGGACAGAGTGGAGGAGTCCATCCGCGTGCGCGTGTACGACCAGGACCTGAACTTGACCCTGCTCATGGTA
CAAACTTCGTCAAAAATGCCCGTCGCCATGTCTGACTTGTACGACCACTTCAATGTTCATTGCTACAGCAAGCGGATGAGCTCGCTCCGTTTTTCCGGCG
CCGCGTGGGGGGCACGTTGCTGTGGGACGCCGCTGTGCACTTGACGAGGCGGTTTCTGGTCGAATATCGCCAGGAATTGGCGTCTTCGACCAATTCGCTG
CGTGTTTTGGAACTCGGTGCCGGCATGTGCGTAGATGCTTGTCACTTGTTGAGAAAGCGGTGCTGACAATGGTGAGTTGGTGACATTTTGACACAGTGGC
GTGCCCGGTATGGCGGCGCGTGTTGCAGGGGCCAA