Description :
From Genome Similarity Track
Location :
Scaffold_362:5673- 13344
Transcript NameFunction/comments
g17214.t1POM68377.1 Hypothetical protein PHPALM_15469 [Phytophthora palmivora var. palmivora
g17215.t1hypothetical protein

Sequence
7671 bases(100 bases per row)
ATCTGGGACATCTTGCATTGGCTCACGCTGGATCGCTCTTCAGATGCGCCGCCGGGAATTCTCAAGATTCAGACCAAGCGCGCTCGTCGTCATGAAGGTT
TCCGAAAGAAGGCCTTGGCACTCCAGAAGAAGTTGTCCACCAAGTTACCGTCTAGCATCTGGAACGAGCCTGGTGTTTGGAAGTTCCCAAACAAGATTTG
CCACTGGATCCTGATGGACAAGCAGCATTTCAAACCAGGGACTTCCGAATGTTACTCGTTGCAGGAGCAGATGGAACTTCTGGACCGCCGTGAGCCTGCT
CGCGCGCAATGGAGCTTCTGTTCCACGGATGCAGAGCGCATCGCCCACCTCCCGGAAAACGTTCGTCGCGGTCTGATTCCTGCTGATGAGCGGGATCCAG
TCACTGACATCTTCTCTTAGTCTTCCATTGGCAATCCATCCGGACGTCGTCACATATCTGCACGTTTTTCTCTTCCAGTAGTCTCAAAGTTAATCGTCCG
AAATATACTCACTTGACTTTCCAAATGTTCCCAATCACAACTTCCCATAGTATCCACTTCTCGAAATTCGCCACTTACAATACACACTCGATACTCACTC
CAATTTCACAGCAATATAATCACACATTTCCAAAAGTCCGTTCGTCTGATCCATCCAAGAGGATGATATCTCGAAGGCCTAAACTCTTGGATGGTCATCA
CCTGCTTGCATAGTTTGGAAGCGAGCTCTCGCACGTGCACCTTGGTTGAATTCATAGAGTAAGGCACCACAGCTCAATTGTGTCACTGGTAACCACTCGG
GTTCATCATAGCCTTTCCACTTGATGAGGTACTCTCGGCGCCGCCTGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAACTTCGTA
CTCGTCCCTTCCAGCATCCGGTTCCCAACTGTCTTCTGGAAGTAGTGCAGCATCAAAATCGTCATCCTCGTTCACGTTCAACTCCATATTCGGGCGTTTT
GGAAATAGAGCCCGGGGCTTCAAACGACTGATGTGCACCCAAGGGTTGACACGATATCCGGTGTCCTCGATCTTGAGCTTCACCCTGAAGTCATTATGCA
CTTCCTCAATTCGGAAGGGGCCATGCCACATGTGGGCCAACTTTCTGCTCAGTCCAGGTTGGACCTTCGGGATGTACAACCACACCAGGTCACCCACTTC
GAATCCGGACTTCAGTCTGTCGGAAAGTTCTTTCCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGCCTTCTGCACATGCT
TTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGTCGCCACTCATAAGCGGTCCTCTCCTGAAGACTTGATGGCTTCGGACCCAACATTGCAGATAACGTCC
CTTGGGTATCCCATCCGTGAACCAGATAAAGTGGCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATGATCGTC
CCAATCGCTCTGATCCGCTTCCGAAATGTACGCACGGATGCTCCTGACCACCGTCTGGACGGATCGCTCCTGTTGGCCATTTGCCTGGGGACGATATGCC
AGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTCGGAAACGGGTGAACACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGCAACATCGAACTTGCTC
CAAACCTTCGGAAGACGCACTCTTCATAAGCTTCCGCTACATCCTGAGCTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGCATCTTG
GAACAAAAGCAAAAAAGTGTTCCCACGCTCGGACTTCGGCATGTGCGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTAGGTTCGATGTTTCCA
GGCGACGGACCAGCATTCGGAGGTCGTCCCTTGCCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACATCCGCATACATCCCAGGCCAATAGA
ATTCCGAACGCAATTTCTCGTGTGTCCGAGTGATGCCTTGATGGCCGCCCTGATAATCTTCGTGCGCATAGTGCAGCATATCTGGACGGAGTGACTTCGG
GACGACCAGCCTTGGCTCATCCACAAAGTCCCTCGGGCGGTCTCGGGTAGATCGTGCAAGTCGGTACAGCACATCGCGAGTGTCGAGCGCAAACAAGTCA
GCAACTTTGGCAATCTTTCGGAGGCGTCTGGGTGAGAATCTGTCAACTCCACCCTTCAGGAAATCTTTGATCTCTGACAAGTACTCGTCTTCTTCCTGAT
GAACTTTGATGCGACGCCATCTTTCCGCTTGGAATTCCAGAGGTCCCATTGGTGGTCCATCCAGAGATTCGGTGGTTTGGAGGCCTGACCTCGTCATGAC
TGCCATCACTCTGGCGGCTGCCGACAACGGGGCAGAGTCAGCATCAGGAAGCACCGTTCCTACCTGAGCGTCCCTCGCATCAGAACTTCCGAGTCCCACT
GGACTGGAACTGTCATCGCCATCTGGAGTGTCAGTCTTCGTGACCTTTTCGGGTATTTTAGACACTACTTCCAGGTGTCGGAGCTCATGTTCATCTTGGA
CTTCCCATGACTCACCCAGTAGCAACGTCTTGGAAGTCAAGTAATCGGCGGCTTGATTGTACTCCCTTTTGAGGTGTGCCAGCCTTACCGTCCGGAATTT
GGCCTTCAGAACATTAGCCTCCGCGAGATGCTTTTGCAGGTGAGGCTGATTGCAATTGATTAACCCTTGCACTTGCTGAATAACAATCCGGGAGTCACCG
ACCACGAATAGATCTTCGACATGATGTTCGGAAGCCATCGCCATACCTTTCAGAAGTCCATAGTACTCAGCGTCATTCACAGTAACATCTTTCAGAATAT
AACCATGTGCTTCTAGAACGGTCCAACCGGGCACCTTCCAAAGGATGCACCCGCACCTTCCTTGACGAGTCGATGTCTTGGCAGCTCCATCGAAGCTAAG
GACGATCCCATCGTAATCTGCATCCAACATCTCAACACTCACCACAGGCGGCTGCCGGATCTCACCTTTCGCTGGAATCAATGATTCAGCAACTTTGTCT
AAGTGTTCACGCGGAGTGATCCCAGCGCCCATGATAGCAGCCAGACCGTCCTCGTCCCGTTGAACCTTCCGGATTTCCATGTTCCACCCGGATAACGCAA
GTCCCCATGGGACGCATCTTCCATCGGCAGATTTAGAGGTGATGACCCACTTCAGAACGGAGTATCTCGTATAGACGATCAGTGGACAATGTTCGACAAT
CGTCCGGAACACCTGAAGCACCCTCATGATAGCGATCACCTCTTTCTCGGCGACATGATACCTCACTTCGGAGTCGTTCAGGACGCGGCCGGTATACCTG
ACCGGGTGTATCTTCCCATCATATTCCTGCCCGAGGACTGCACATGCGGCCCACTGATTGGCATGCGGGATGATGACAAACGGTCGGGAGCGATCCGGAT
GGCGTAGCAACGGAGTTGAGACAATCTTCCGCTTCAGGATTCCAAAGGCTTCCTTAGCTCTTGACAGATTACGTCCTGAGCGCACTTGGTCATCCGAGAG
TTCATACAGCACCGCAGCTACCACTGGAAAGTCCTCAATAAACTTGTGATAGTAATTGATACTTCCGAGGAACGATTGTACTCCTTTCAGTGTGCTTGGG
AACGGCAAGTCCTGAACGCCTTTCGCAATCTTAGGTGTCGCCCGGATGCCTTCAGCACTGATCTCGTGCGACAGATACGGGATCGACTTCTTTCCGAACT
CACTTTTAGGGAGGCTCACGGAAATATTTCAGTACCTCAACCTGAAAAGGAGTGCGTTCAGATCATCACAAAGTTGGTCCCAGGTTTCAGCTCCATGTGC
AATGTCGTCGATATAGGAACTACGTCCCAAGACAGGGCCCATCTGAGATGGCGCAGGGATATTCCTTTTGAACACCGTCATGTACTCAGTCAGCGTCGGG
ACTTCAGGATTAGTATCCACATCCAGAAGATTGGCTGCCGGAGGGGGCAACTTCAGGAAATCCAAGACGTCTTGGTCGACTTCAGCTTCTTCCTCTGGAG
GCAGCCGGACGAATCCCCACAGGCAGTTATTAATTACTGCCTGATACACCAAAGGCGCGTTTTTGAGTCCAAACGGCATTCGCACCCATTGGAAGTGTCC
AAATGGACACACAAAAGCCGAAATCAACTTGGCACGCTCTGACATTCGAACCGCCCAGAATCCACTGGCCATATCTAAGCTCATGAACCACATTGCATTC
TCAAATCCGATCAGTAAGTCATCAATTAGTGGTAACGGGTAGTTCGAAAGTTCGATAAAACCATTGACGATCCGGTAATCAATACACATCCGGATGTCCA
GACCGTTTTTCTTCAGGACAATCACGATCGGAGAGGACCATGGTGATTCGGAAGGTTCGATCAATCCAGTTTCCAAGAGTTTCTTGAGTAACTCATAGAC
CTTGATAGCCAGATGAGGTGCGATGGATCGGGCGCGTTGTGCGACCGGCTTGGCCGTCCCAACGTCCAAATCACAAATCACCCCTCTTGCTGGAGCAGGA
GCGGCATTTCCATCACCCAGAAAAATAGAGCGGTGGTACTTCAGGATGGACCGAAGCTTCTGCTCTTCCAGAGGTGATGTCGTTTCCGAATCTCCCACAT
CAGCCGCATCAATATCACATGTCGGGCTCAACTCTTGGAGTTCCGGAAGCATCGCCAGCTGATCACGCAATTGGGCTAACAAGTCACTTCCTTCATGGAT
GTACACAGCGGGTTCCAAATCCAGCTCTTCTGCGTTCAGACGCATGCACCTCTCATACTCGACTTTCAACTTTTAGATTGGGGTAGAGAGCATGGCTTGG
GTTTGCTGATCCCGGAGTTCGTCCAATCCTGACAAGTCATCCAGACAATCGTTCACATCGTCAGCACCTTCATCCGGAAACTCTTCATTCAGGCTAATCG
AATCAAAGAATTCATCTCCGTCCGAATCCACGTCGTCCGTCAGAAGTTCTGCGCCTTCCAATCGTTCTTCAACCCTTGGTATGACCTCCGACTCCCTTGG
ATGACATCCGTCGCCAGTATCTTCCGGACGTGGCACTTCCTCAACCTCAGGGTCTTTTTTCAGCTTTACCGTGTTTTCTGCGATGACTTCATCTGGAAGA
GTTTCCTCCACTTTCGGACGTAAGACTCGAGGCAGCTCCTGAAGTTGCACCATGTGAACTTGGTCGCTTCCAGGAAGCGGTCGAACCAATAGCTTAGCCG
GCCATGAGTATTCGGACTTCTGGACGCAAGGAGGTTCGGCGTCCCTCATCATCTGCTCAAATCGTTCAGAACGTAAACGCATCTGATTGGATTCGGTATT
CTCATAGATGAGAGTCTGCCACTCCTGATACCTTCGGAGACCCGGGCGGACAAAACGTCCTGCCCTCGGGAAGAAGCCAAACGCGATGATCCGAGCAACC
GGCGTCCGAGTGTCAATGCTAAGACACCTTCCGGAAATGTTCACCACTTTGATGGCCACAGCCCACGATCTAGCAGCATAGATGATCTGGGTTACCCATC
GGTCTCCCCGACCAGCCCATACCACATCACGTTGTGGATTGCTCTGTCCGTAATGTATCCGGACGATAGCATGTTCACCTGGGCGCAGGAAAATCTCTTC
ACGCGGTCTCACCGGAAGGTCCAAACCTCTGTGGTAATGATCCGTACCACGTCCTGATAGCAACACGGTTTCTTCACCCGGAAGTTGCACCAATCCTTCT
CGTGCGCACAGTCGCACTCCAGCGAAATACATGAAATTCATTCCAAGCAACACGTCGACACCTTCACCAATGTTCGCGACCCAAAGTTCCAAGACATACA
CAATTCTCGGACCCAAAGTGATTTTCACTTCAGCACTCGCGGTGATGATGGTCGGAACGCCACCCAGTCCAGATACCCGGAGCTGTTTGCAGAAGCTTCG
TTTGAGTTTGAGTCTACGCGCAAGGTCCAAACTCACCATGCTTACTGACGCTCCAGAATCCAAAAGGATGTCTGTCCGGCAATTGTTTACCGCTCCATGA
ACCATCGCAATCCGTTTCGTGTCATCCGAACAGTGAACTTCCTACCAGCCATATCGTTCGCCTGGTCCCAGTCGGAATTCAACAGGTACATCCGGATCTT
GTACTTCCGGCCGTACACCTTCCGACAGAACTCGTTCAGGACGAAGTTCATCAGAAAGAGGGTCACCACTTTCCGGAATCACGGTCATGCCTTGATGTTT
ATCCTGTTTTTGGCGTCTCAACTCCGGACCAACATACACTAGAAGACACATATTGGGGGGGGGGGTTCTTCAGCCCGTCGCGTTCTGGATCCCCATCCAG
CGGGCTTACTAGTTTAACGGCTGTTCCCCTGGATCCACGTTCCCTTCCAGAAGTTGCTTCCGGATAGGAGACGGCAGATCTTTCAGTGCTCCTTGACGTG
CAAGATTCTTGATCGCTTGAAAAGCCTTCCATTCTTCACACTTGCCTTCGTGAAACTGGTTACAAATCACACACGGACGAGTCCTGCTGAGGTGTGTCGG
ATGTCCCATCCGACGGCATCGATCACATTCAATGTCCGACCAACAATTCTCCGTCAGATGTCCAAACTCTTTGCACTTGTCACAGAACTTGGACGCGTTC
GGACTTCCAAAACGTTGCTGCCGGCGATCCGAACGGAAATCAGAAGTCGGTGGCCGCCATCCAGGATTCTCTATCGCACGAAATACTGCTTCGGAAAGGT
TATCCATGCTCGAACCGGACACGTTCGTGGCATCCGCAGTTGAAGTAGGTAGCACACTAGGAGCATGTTCTCGACTTGTCACTTCTTCCACATCTTCCAA
AAAATGGACTTGTCTGTCATGTTCGCCATCCCGGTTATCGTCATCGTGAAGGACATAGGCCCTTCCAGAACGTTTCGGTCGGAATCGATCACGAGGGACA
TTGTCCGCTCGGAAGTCTCTCTTCGGAGGTGGAGTATCGTAGTCGTCGTCTTGATTCATTTCTTCATGCTGTTTCAGGACATATTCCAAGTCCTTCAGAC
GACGCAGACGTTGTCCTTGCAAAGTCGTTCGGAGGCGGGAGTCCAGAAGCTTCTTCGTGAACACTTTCAGATGGCGCTAACGTTGCTTACTCGATGCGTC
GAACTCGATCCCAGCTTTGTCGGCCACCTTGTTCAGGCGGTAGTAAAATTCCAGCGGAGTTTCTGCCTTCTTTTGGATCATCGTGTAATAACGTTCTGAA
TCCGAGGTCTTGGCCTTGCAATACATATCTCGGAACTCCTTCAGGAACTTCTTCCATTTCCGGCGCATGTTGGGATTCAAGTTCGAACGCCAGTTCCGAA
CGGCAGCAGGTAACTTCAGCTTCATCTCATAGATCTTGACCTTATCCGACCAACCGCCTTGAACAGCAAAACTCTGGAATCGTTCCAACCACCGGATACG
GGTAGCTAGTGACGCTTTCTCATTGAAGTCTTCCAACGTGCTGGCATTCACGTACGGTCTGAACGTGAACAGAGATCCGCCTGGACCTGGTGCCGTATGG
ACATTCGGAACGACATCTTCGAAAGAACTGCTATTTGAACTGTCCGAGTCCGAGTCACTCTTACTGGAGTC