Description :
From Genome Similarity Track
Location :
Scaffold_1695:5673- 7481
Transcript NameFunction/comments
Phypl_g13984hypothetical protein

Sequence
1808 bases(100 bases per row)
CGTGACAGCGCGTTCTCTGTTGGTCAGCTTGCTGTGCCTTGCCTTGTCCAAGTGTGCGCCATCCAGGCACAGAGGCGGCGAAGCACCACCAACGATATAA
TCACTGGCAGGATTAGAGGCAACACACGTTCAAATGGACCgcgccgacgacgtgcaACGGTGCTCGCTGTATTCCTGTCCGCTCTCCCTTGCCGAGCTGA
TGGACGCTCAGCACCAGCCTTCTCAAGCCAACCATGAAGCGGACGCTGCGACACCAAGCGGGTCGCTAACAGGGCCGATGGACTGGAGCAATATCAGCCC
CTCAATGCCGCGCGAGGCTCAGGGAGAGTACATGTCGCTCTTGACTATCTCTCCGGCCGGCCCGGTGCAAACTGCTTCAGTGCCAGAGGATGATGCAGAA
TCGGCGACAGCTACCTTCGGTGGGGAGAAGGTAGCCCGAGGCGTGATGACAGGGGAGAAGCAACGCCCTTCAGCAAAGGAGAAGGTTGCACCCATGGAGG
AAAGAAGCTCAGGGAGAATGAAGAAAGAGTTGCAGACAAGAGAGGCTGGTGAGAAGATCCAAACAAGGGCTCACGCTGCGAAAACCAAGCCGAAGACTGG
CAAGCGGCTGAAGTGGAGCAACGCTATGGTAGCagagctgcttcgccttcgttTCAAGGACGACGAAATGAAAAACCGCATCGACTCCGCGGATACCAAG
ACCAAGGCGGCGCTTGCCTGGCAGTTCTTCGCCAGCAAGCTGTCGCAGGTACTGGGGCTAGTCATCACCCAGGAACAGGTACCTACCCTTTAAAATTGCT
AACTACCACTCCGTTCCAGATCACTTGTCCACTTTTGCTAGCGCAGCTCGGGATTTGTCAATATTGCTCGGAAACGACTGTGGTTGGGATTAAAAGAGAT
CTGGCGTCGGCGTCATTGGAATGGTGTGCGGTTCTCCAAGAGGGAGTCCGTATTGGCGCCTGGGTGGCCACGAGAGTTCTTTTGGAAGCTTCGCCGGGAG
GGGATACTTCCTTTGAACAGTCCCTTCTCTGTCTTATTTGTCTCGGTTATACGTGCGTTAGGTAGCACACACCATCCAACCATAGTTAATCTTAGTATAA
ATGGAGGACAAGTAATCTGAAACAGGTCAAAGGAGTCCATTTGAAACGGAATGATCGTTAAGCTGTTTGTGAGTTTTTTTACTAGAGGGTTTTGAAGTTG
CGCCATCGATTTTTCGTATCTAAACGGGAGGCGAGAAAACGGTGGAAAAGCAAACTACTCCAGATCGAGGCATACGATACGTTTGCCAAACTTGCTCCAG
ATATGCATATAAGGCATAGATTAGATTCCGGTAACAAGTACCACTCTGTTCCAGATCACTTATCCGCTTCAACATTTGAGTCCATTCAAAACCAAATGAT
CGTTAACTATTTAACCTCAAATTGGAGTTGCGCACACCATTGAAAAGCTGAGCGTCTGGACTACACGACAGAGCCCTTGCTTGCCAAACCCTTGGGTAGA
ACAAACGTTATGGCGGCTTAAAAAAGTATCTCCTTGCTGAAGGCATGTGGTCGAATTTCTTTTCTTCGGTCAAACTGATCTGCAGGCAATTGTGAAGCGA
ACAACGTCTTCTAGAGCTCCTAGCAAGGTCTAGAACCGTTTGAAAAAGGCACGTGAAAGTCTGCCTTCGTTAACGATCATTTTGAATTGAATTCCTGGTT
CCATGTCCAACACATGGTTCAGCCAATTAGATGACGGCTTCATTGACGATTTGACTTCTTGTTTACGGCTAATGAAGGCCCCCGACACACAACACCAACG
ACCGGAAG